Labshake search
Citations for Qiagen :
1601 - 1650 of 2083 citations for 7 Oxa 3 azabicyclo 4.1.0 heptane 1 methyl 3 propyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... including DNase 1 treatment (Monarch Total RNA Miniprep kit, #T2010, New England Biolabs, USA and QIAGEN RNeasyMini kit, #74104). Purity and quantity of RNA were assessed by determining the optical density (OD ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was diluted 3 times with buffer A (20 mM HEPES, pH 7.4, 200 mM NaCl, 1 mM Asp) and incubated with Ni-NTA resin (Qiagen) for 1 hour at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 4°C) and the supernatant incubated 1 hr at 4°C with 1.5 ml packed Ni-NTA Agarose beads (Qiagen). Beads were washed with buffer H adjusted to 50 mM imidazole ...
-
bioRxiv - Cancer Biology 2023Quote: ... culture medium was replaced with base medium 1 hour before transfection and cells were transfected with miRNA mimics (Qiagen), including hsa-let-7a-5p (UGAGGUAGUAGGUUGUAUAGUU) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The OsHV-1 µVar DNA was extracted from 200 µL of water using the QIAmp DNA mini Kit (QIAGEN). Quantitative PCR was performed with 5 µL of DNA as described 46.
-
bioRxiv - Cancer Biology 2024Quote: ... doxycycline was added at (0.1 μg/ml, 1 μg/ml (CHRDL2 +) or 10 μg/ml (CHRDL2 ++) RNA was extracted (RNeasy, QIAGEN) and quantified by real-time reverse transcriptase polymerase chain reaction (qPCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... Extract was cleared by centrifugation at 186,000g for 1 hour at 4 °C and then incubated at 4 °C with NiNTA resin (QIAGEN) for 4 h ...
-
bioRxiv - Genomics 2023Quote: ... 1×106 cells were harvested from each culture and DNA was extracted using QIAamp DNA mini Kit (QIAGEN 51304). STR analysis was performed with PowerPlex 21 System (Promega DC8902 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Complementary DNA (cDNA) was synthesized from 1 ug of RNA using the QuantiTect reverse transcription kit (Qiagen, catalog #205311) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: The post-caval lobe of the lung was weighed and homogenized in 1 mL of PBS (pH 7.4) using a TissueLyser LT (Qiagen). RNA was extracted using TRIzol™ LS Reagent (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... The tissue pellets were resuspended in 1 ml of FSW using a tissue lyser (Tissue-Lyser II, Qiagen, Australia) and the resuspension was homogenized using sterile glass homogenizers for 30 s ...
-
bioRxiv - Genomics 2023Quote: ... After overnight proteinase K digestion in Lysis Buffer (BNG) and 1-hour treatment with RNAse A (Qiagen, MD,USA), plugs were washed 4 times in 1×Wash Buffer (BNG ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The lysate was centrifuged at 50,000×g for 10 min and to the supernatant 1 mL of 50% Ni−NTA (Qiagen) was added and incubated for 1 h at 4 °C ...
-
bioRxiv - Genomics 2024Quote: ... 72 °C for 1 min and then subjected to a 1.2x SPRI cleanup eluting in 42 µl EB buffer (Qiagen). Each sample was split into two fractions and each of them was further amplified with modality-specific primers ...
-
bioRxiv - Genomics 2024Quote: ... Homogenization buffer for RNA purification was made by adding 1:100 beta-mercaptoethanol to Buffer RLT (Qiagen, Valencia, CA) and kept on ice until use ...
-
bioRxiv - Immunology 2024Quote: ... The cells were then washed with 1× PBS and treated with 100 μg/mL of RNase A (Qiagen, USA) followed by staining with 50 μg/mL of propidium iodide (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... Material was ruptured two times for 1 min at 30 Hz in a TissueLyser (Qiagen Inc., Germantown, MD, USA). Between and after these two steps of tissue disruption ...
-
bioRxiv - Microbiology 2020Quote: ... We immediately transferred all swabs and film to a microcentrifuge tube with 1 mL lysis buffer and garnet homogenization beads (Qiagen NV ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 µM A740003 or both BzATP and A740003 together (A740003 was pre incubated for 1 h before adding BzATP) 24 hours later RNA was extracted using the miRNeasy mini kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: Protein lysate [1μg/μL] was RNase A digested at 37°C for 15 min following addition of 1 μg RNase A (Qiagen) per 25 μg protein ...
-
bioRxiv - Immunology 2021Quote: Genomic DNA was extracted from 1 B6 and two Card19lxcn BMDMs derived from three independent mice using a DNeasy blood and tissue kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: CIRCLE-seq libraries were prepared for each gRNA (IDT) using genomic DNA extracted from NHGRI-1 (DNA Blood & Tissue kit, Qiagen) following the described protocol [59] ...
-
bioRxiv - Microbiology 2020Quote: ... We sampled 1 ml of the clear phase for living planktonic cells and extracted DNA using DNeasy Blood & Tissue Kit (Qiagen). The cultures were also plated on SHIEH-agar plates with dilutions for cfu/ml -estimation and colony-PCR.
-
bioRxiv - Microbiology 2021Quote: Recombinant protein was blotted with anti-His antibody using the same method: 1:2000 mouse anti-tetra-His IgG (Qiagen); 1:1500 goat anti-mouse IgG-HRP (Dako) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The tissue was ground to a fine powder by adding 10-15 zirconia beads (1 mm diameter) and using a TissueLyser (Qiagen) for sunflower ligules ...
-
bioRxiv - Genomics 2020Quote: PCR amplicons verified by 1% agarose gel electrophoresis were purified from gel using Gel extraction kit (Qiagen GmbH, Hilden, Germany) and ligated into a pGEM-T easy cloning vector (Promega ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was isolated from cavin1a/1b DKO and WT zebrafish embryos (> 100 embryos randomly selected from 1 clutch) using the RNeasy Mini Kit (QIAGEN) and cDNA synthesis was performed using SuperscriptIII reverse transcriptase (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... total RNA was isolated from 1×106 BMMCs that were untreated or treated with IgE receptor crosslinking using the RNeasy mini kit (Qiagen). RNA was treated with DNase I according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... plasmids containing qPCR amplicon sequences were linearized by digestion with SmaI for 1 h and purified using the QIAquick PCR purification kit (Qiagen). Linearized plasmids were quantified using spectrophotometry ...
-
bioRxiv - Molecular Biology 2021Quote: The ER-I-PpoI cells treated with 4-OHT (2.5 μM) for 1 hour were collected for extraction of the total nucleic acids using DNeasy Blood & Tissue Kits (Qiagen) or PureLink(tm ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse tissue disruption and homogenization was performed in RIPA buffer supplemented with 1:100 protease using Tissue Lyser LT (Qiagen), for 5 min at 50 Hz ...
-
bioRxiv - Genomics 2019Quote: ... with the addition of 20 μl of proteinase K (20 mg/ml) followed by incubation at 56°C for 1-2 hr and the mitochondrial DNA was extracted by Qiagen DNeasy Blood & Tissue Kit (QIAGEN Inc.) ...
-
bioRxiv - Genomics 2019Quote: Total RNAs from the knockdown (shCTCF#1 and shCTCF#2) and control (shLuc) cells were extracted using miRNeasy Micro Kit (QIAGEN). cDNA was synthesized by using oligo (dT)20 and SuperScript III Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Genetics 2019Quote: ... The resulting products were then either treated with DpnI or purified from a 1% agarose gel with a QIAquick Gel Extraction Kit (Qiagen) and transformed into E.coli DH5α competent cells (Invitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... viral DNA was either extracted using modified phenol/chloroform extraction routes (Figure 1, Route A-D) or QIAamp Viral RNA Mini Kit [22] (Qiagen) according manufacturer’s instructions (Figure 1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Pellet was treated with 20 μg lysostaphin (1 mg/ml) and RNA isolation was performed using the RNeasy Plus mini kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Kinetochore proteins were conjugated to these beads using antibodies that recognize specific proteins or their tags: biotinylated anti-His-tag antibodies (6 µg ml−1, Qiagen), biotinylated anti-GFP antibodies (20 µg ml−1 ...
-
bioRxiv - Neuroscience 2019Quote: RNA extraction from 1-10 x104 FACS-sorted microglia or iPS-derived microglia-like cells was performed on the QIAcube (Qiagen) using the RNeasy Micro Kit (Qiagen ...
-
bioRxiv - Cell Biology 2019Quote: The decellularized Balb/c mouse pancreas scaffolds were washed in PBS and homogenized-lysed for 1 hr in Tissue homozilyser II (Qiagen). The ECM proteins were dissolved in lysis buffer containing Tris HCl 0.06M ...
-
bioRxiv - Immunology 2019Quote: ... longitudinal muscle/myenteric plexus preparations were homogenized in a 2 ml eppendorf containing 1 ml Trizol and a single 5 mm steel bead in a TissueLyzer (Qiagen) for 3 min at 30 Hz ...
-
bioRxiv - Immunology 2019Quote: ... mucosal scrapings and feces were homogenized in a 2 ml eppendorf containing 1 ml of DNA extraction buffer and a single 5 mm steel bead in a TissueLyzer (Qiagen) for 3 min at 30 Hz ...
-
bioRxiv - Cancer Biology 2019Quote: ... The lysate was then centrifuged at 15 000 ×g and the supernatant was added to the 1 mL Ni-NTA resin (Qiagen). After washing with Buffer A supplied with 30 mM imidazole ...
-
bioRxiv - Microbiology 2019Quote: ... total RNA was extracted from 1∼5 million PBMCs into 30ml of water with RNeasy Mini Kits (Qiagen, Valencia, CA). For unbiased repertoire analysis ...
-
bioRxiv - Genomics 2019Quote: ... We washed the pellets with 1 ml 70% ethanol and air dried before resuspending the libraries in EB buffer (Qiagen).
-
bioRxiv - Developmental Biology 2019Quote: Total cell lysates were generated in RIPA buffer (1% Nonidet P40, 0.5% sodium deoxycholate, 0.1% SDS in PBS) by homogenization with a Tissuelyser TM (QIAGEN, Venlo, Netherlands) at a frequency of 30 Hz for 2 minutes at 4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... 1.2×106 cells were plated into each well of a 6-well plate and transfected with Sns and Eff-1 constructs (200ng each) using Effectene (Qiagen) per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: Amplicons spanning the gRNA target sites were amplified from 1 µL of purified gDNA using HotStar PCR Master Mix (Qiagen). Half of each reaction was run on a 1.5% agarose gel ...
-
bioRxiv - Genetics 2020Quote: Bone marrow was isolated by flushing and red cell lysis performed by resuspending pellet in 1 ml of Buffer EL (Qiagen) and incubating on ice for 15 minutes ...
-
bioRxiv - Immunology 2021Quote: ... The PCR products were subjected to 1 % agarose gel electrophoresis for analysis and purified with QIAquick PCR Purification Kit (Qiagen) according to the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2020Quote: Initial crystals of Nup133NTD-VHH-SAN5 were obtained at 18°C in 1 day as part of the Protein Complex suite (Qiagen) in a 96-well sitting drop tray with a reservoir containing 15% PEG MME 2,000 ...