Labshake search
Citations for Qiagen :
1601 - 1650 of 3581 citations for 6 Methyl 3 4 dihydro 2H pyrido 3 2 b 1 4 oxazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The MLB and MLBE tubes were then subjected to bead-beating for 6 min using the TissueLyser Lt (Qiagen®, Hilden, Germany), with the instrument set at 50 Hz ...
-
bioRxiv - Physiology 2023Quote: ... proximal intestine and distal intestine (n = 6 per sampling day and diet) according to the miRNeasy Tissue/Cells Advanced Mini Kit protocol (Qiagen, Hilden, Germany). RNA was treated with the Turbo DNA-free kit (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... Key genes involved in the regulation and enzymatic pathways of fatty liver were simultaneously assayed with the RT2 Profiler PCR Array Human Fatty Liver (PAHS-157ZC-6) (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions and analyzed with the Data Analysis Center (QIAGEN Hilden ...
-
bioRxiv - Developmental Biology 2024Quote: ... E17 and P0 (n=6 embryos per sex and time point) using the Qiagen miRNeasy mini kit (CatNo. 217004; Qiagen; Hilden, Germany). 500 ng of total RNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Molecular Biology 2019Quote: ... tumefaciens culture was added to 2 ml RNAprotect Bacteria Reagent (Qiagen) and RNA was isolated using RNeasy columns (Qiagen) ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Microbiology 2024Quote: ... cleared lysates were incubated with 2 mL Ni-NTA agarose (Qiagen) on a rotator for 1 hour at 4°C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... total RNA and genomic DNA was extracted from flash frozen testes of a subsample of males 6 to 10 days following injection with the dsRNA using a Qiagen Allprep DNA/RNA Mini Kit (Qiagen, Venlo, The Netherlands). Expression levels for Dnmt1 was analyzed using qRT-PCR as described above.
-
bioRxiv - Plant Biology 2020Quote: ... and whole seedling shoot of 8-day-old seedling (Figure 2C and Supplemental Figure 6) were used to extract RNA using the RNeasy® Mini kit (Qiagen, Hilden, Germany) followed by DNase I (Qiagen ...
-
bioRxiv - Cancer Biology 2019Quote: Cells were seeded in 6-well plates 24 h prior to isolation of total RNA using a RNeasy Mini Kit (QIAGEN, Santa Clara, CA). mRNA levels for EMT-related genes were determined using the validated primer sets (SA Biosciences Corporation ...
-
bioRxiv - Immunology 2023Quote: ... The first round of PCR was carried out using the ImmunoSEQ proprietary PCR primer mix (32 μL per sample containing 25 uL of QIAGEN 2× Multiplex PCR Master Mix, 5μL of QIAGEN 5x Q-solution and 2 μL of primer mix). A positive control reaction ...
-
bioRxiv - Plant Biology 2020Quote: ... at 65°C overnight and treated with 2 μg RNase A (Qiagen) for 1h at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Generation of cDNA was performed by GoTaq 2-step RT system (Qiagen). Real-time PCR reactions were measured by ABI StepOnePlus system using SYBR green qPCR master mix (ThermoFisher) ...
-
bioRxiv - Microbiology 2019Quote: The Microbial DNA qPCR Array Intestinal Infection 2 kit (Qiagen, Hilden, Germany) (Supplementary table 1 ...
-
bioRxiv - Immunology 2019Quote: ... pelleted and lysed in RLT Plus buffer supplemented with 2-mercaptoethanol (Qiagen). The RNeasy Plus Mini Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2019Quote: ... Tubes were shaken at maximum speed (30) for 2 min (Qiagen Tissuelyser), vortexed ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 2-mercaptoethanol and purified using the RNeasy Micro kit (Qiagen).
-
bioRxiv - Cell Biology 2021Quote: ... 6xHis-tagged CDK-2 was purified using Ni-NTA resins (Qiagen 30210) and eluted in PBS ...
-
bioRxiv - Microbiology 2020Quote: ... except that 2 mL prefilled bead tubes (Qiagen; catalog no., 13118-50) were used for the bead beating ...
-
bioRxiv - Plant Biology 2019Quote: ... treated with 2 mL of RNAprotect bacteria reagent (Qiagen, Germantown, MD, USA) following the manufacturer’s instructions and the samples flash-frozen in liquid nitrogen and stored at −80 °C until further use ...
-
bioRxiv - Microbiology 2019Quote: ... and high-speed shaking in a TissueLyzer device (2 minutes, 30Hz; QIAGEN). Samples were stored at −20°C.
-
bioRxiv - Microbiology 2022Quote: ... (2) PCR purification was conducted using the QIAquick PCR Purification Kit (Qiagen), and (3 ...
-
bioRxiv - Neuroscience 2020Quote: Primary microglia or BV-2 cells were collected in RLT buffer (QIAGEN). RNA was isolated using RNEasy Micro or Mini Kit ...
-
Coding and non-coding drivers of mantle cell lymphoma identified through exome and genome sequencingbioRxiv - Genomics 2019Quote: ... from pellets of 2 × 106 cells using the RNeasy mini kit (Qiagen) or RIPA buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 2 μl of 10 mg/ml RNase (Qiagen Valencia, CA, USA) was added to each of the samples and kept at 4°C for 30 minutes to remove fragments of RNA strands.
-
bioRxiv - Physiology 2020Quote: ... crushed at 50Hz for 2 minutes with a TissueLyser (Qiagen, ref 85600) and centrifuged at 10000g for 5 minutes at 4°C ...
-
bioRxiv - Genomics 2021Quote: ... and a 2% agarose gel using the QIAquick gel extraction kit (Qiagen). In a second PCR ...
-
bioRxiv - Genomics 2021Quote: SARS-CoV-2 RNA was extracted with QIAamp Viral Mini Kit (Qiagen) in a QIACube extractor or with Maxwell® RSC Viral Total Nucleic Acid Purification Kit (Promega ...
-
bioRxiv - Microbiology 2024Quote: ... The cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) on a rotator for 1 hour at 4°C ...
-
bioRxiv - Plant Biology 2022Quote: ... Plant material was then homogenised for 2 min in a tissuelyser (Qiagen) using adaptors kept at −70 °C ...
-
bioRxiv - Physiology 2022Quote: ... with 2 cycles in a Bead Beater TissueLyser II (Qiagen, Germantown, MD) at 24 Hz for 2 min each ...
-
bioRxiv - Microbiology 2024Quote: ... or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0, Qiagen). Then ...
-
bioRxiv - Immunology 2024Quote: ... 2 × QuantiFast SYBR Green PCR Master Mix kit (QiaGen, Cat No. 204056) was used following the manufacturer’s instructions ...