Labshake search
Citations for Qiagen :
1601 - 1650 of 4373 citations for 3 4 Hydroxy 5 isopropyl 6 oxo 1 6 dihydro pyrimidin 2 ylsulfanyl propionic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... 3 min in 37°C shaker) and processed with DNeasy Blood and Tissue Kit (QIAGEN #69504). Two hundred ng of genomic DNA was used as input in the DamID protocol that included an improved pool of AdR primers as described (de la Cruz Ruiz et al ...
-
bioRxiv - Cancer Biology 2024Quote: ... and total RNA was extracted using the RNAeasy Mini kit (Qiagen, 74104; n = 3 independent experiments). Prior to library construction ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were mechanically disrupted for 2x 3 min at 30 Hz (TissueLyser II, Qiagen, Hilden, Germany). This was followed by adding 5 μl of proteinase K (20 mg/ml ...
-
bioRxiv - Microbiology 2023Quote: ... whole eyes were homogenized in PBS using a TissueLyser II (Qiagen, 30 Hz for 3 minutes), and homogenates were serially diluted and streaked on LB plates for quantification of colony forming units (CFU ...
-
bioRxiv - Microbiology 2024Quote: ... Demultiplexed raw reads were trimmed for quality and 3’ adaptors using the CLC Genomics Workbench (Qiagen). Reads were mapped to PAO1 ...
-
bioRxiv - Microbiology 2024Quote: ... whole eyes were homogenized in PBS using a TissueLyser II (Qiagen, 30 Hz for 3 minutes), and homogenates were serially diluted plated on LB agar plates for quantification of colony forming units (CFU ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 independent PCR reactions were pooled and purified using the QIAquick PCR Purification Kit (Qiagen #28106).
-
bioRxiv - Genomics 2024Quote: Genomic DNA was extracted from 3 × 106 cells using QiaAmp DNA Blood Mini Kits (Qiagen 51104) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Amplified 3’UTRs were size selected and purified using the QIAquick Gel Extraction kit (Qiagen, #28704) following manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... Small interfering RNAs (siRNAs) targeting human AKR1C1-4 were synthesized by Qiagen (Valencia, CA). HepG2-RC cells (5×106 cells/well ...
-
bioRxiv - Biochemistry 2021Quote: ... 4 μL sample) were run in duplicates in a Rotor-Gene Q machine (QIAGEN) using the appropriate primer pairs.
-
bioRxiv - Neuroscience 2021Quote: ... and 4 were resuspended each in 117 µL of Lysis Buffer RLT Plus (Qiagen), vortexed ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... at 4°C until DNA preparation using the DNeasy Blood and Tissue Kit (Qiagen) according to the manufacture’s recommendation ...
-
bioRxiv - Microbiology 2022Quote: ... the Qiagen MagAttract PowerSoil DNA Isolation Kit (Cat#: 27000-4-KF; Qiagen, Carlsbad, CA), against five other extraction kits ...
-
bioRxiv - Plant Biology 2021Quote: ... and purified with the MiniElute PCR purification kit (QIAGEN, Cat. No. / ID: 28006×4). The purified genomic DNA fragments were end-repaired and had an A-tail added to the 3’ end ...
-
bioRxiv - Molecular Biology 2020Quote: ... thaliana were homogenised with zirconia beads YTZ-4 and TissueLyser II (Qiagen, Hilden, Germany), and total RNA was then extracted using the Maxwell 16 LEV Plant RNA Kit (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was collected and incubated with 4 ml of Ni-NTA agarose (Qiagen) for 2 hours at 4° C ...
-
bioRxiv - Cancer Biology 2023Quote: ... washed and RNA was extracted from 4×106 cells using the RNeasy kit (Qiagen) (performed in triplicate) ...
-
bioRxiv - Immunology 2023Quote: ... Larvae were euthanized at 4°C overnight and homogenized with a tissue lyser (Qiagen) at 1800 oscillations/min (30 Hz ...
-
bioRxiv - Bioengineering 2024Quote: ... and was then subjected to Ni-NTA affinity purification at 4 [(Qiagen, Valencia, CA). The column was adequately washed with 20 column volume of wash buffer containing 50 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Neuroscience 2023Quote: ... and tissue was homogenized at 4°C in a tissue lyser bead mill (Qiagen) for 2 min at 20 Hz ...
-
bioRxiv - Biophysics 2023Quote: ... 4 °C and the supernatant was loaded onto a NiNTA column (Qiagen, Hilden, Germany) previously equilibrated with washing buffer (20 mM Tris pH 8 ...
-
bioRxiv - Cell Biology 2024Quote: ... treatment or remission serums (n = 4 repeats/condition) using the RNEasy plus kit (Qiagen). Libraries were generated with the KAPA mRNA HyperPrep Kit (Roche ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA from MCF7 cells was isolated by proteinase K digestion at 65°C for 30 minutes followed by purification using the QIAamp circulating nucleic acid kit (Qiagen, Venlo, The Netherlands). Genomic DNA from frozen tissue sections of colorectal liver metastases was isolated using the NucleoSpin Tissue kit according to the manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA was then purified using a nucleic acid binding column with on-column DNase treatment (RNase-free DNase set, QIAGEN, Germantown, MD, USA). RNA was then eluted from the column in elution buffer.
-
bioRxiv - Genomics 2022Quote: ... Nucleic acids were extracted at CNM using either QIAamp MinElute Virus Spin (DNA) or QIAamp Viral RNA Mini kits (Qiagen, Germantown, MD, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: Pathway analysis was performed to integrate the targeted amino acid results using the Ingenuity Pathway Analysis Software (IPA) version 70750971 (QIAGEN, Redwood City, USA). Metabolites strongly correlated with tumor weight were identified using Spearman’s rank correlation analysis ...
-
bioRxiv - Bioengineering 2024Quote: ... The clarified supernatant was loaded onto a pre-equilibrated gravity flow column of nickel-nitrilotriacetic acid (Ni-NTA) beads (Qiagen, Germantown, MD, USA). The column was washed with the increasing concentration of imidazole and the recombinant nanobody protein was eluted at a gradient of 250-500 mM imidazole concentration in elution buffer (50 mM Sodium Phosphate ...
-
bioRxiv - Microbiology 2024Quote: ... 140µl of the sample suspension was used to extract total viral nucleic acid using the QIACube QIAamp viral RNA mini kit (Qiagen, Valencia, CA, USA) using the QIACube extraction instrument (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... root or shoot tissues were ground in 2 mL tubes (Qiagen) containing 3 chrome steel beads of 3.2 mm diameter (BioSpec Products ...
-
bioRxiv - Microbiology 2024Quote: ... for 2 hours and purified using QIAquick PCR Purification Kit (Qiagen). Guide RNA sequence was ordered as oligos (Tm = 51°C ...
-
bioRxiv - Microbiology 2024Quote: ... cells were treated with 2× volume of RNAprotect Bacteria Reagent (QIAGEN) for 10 min at room temperature and collected as pellets by centrifugating for 10 min at 5,000×g ...
-
bioRxiv - Genomics 2024Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...