Labshake search
Citations for Qiagen :
1551 - 1600 of 1879 citations for Alpha 1 acid Glycoprotein AGP AAG since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and the purity of the purified proteins was checked by SDS-PAGE and western blot using anti-His antibody (1:1000, Qiagen) as primary antibody ...
-
bioRxiv - Microbiology 2023Quote: ... The protein concentrations of all the collected samples were adjusted to 400 μg mL−1 using the Qubit protein broad range assay kits (Qiagen). The Cyclic AMP XP® kit ELISA plates were prepared according to the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... Amplicons were resolved on 1% agarose gel by gel electrophoresis and purified using the QiaQuick Gel Extraction Kit (QIAGEN #28706). Purified PCR product was cloned into the TOPO TA Vector and transformed into OneShot TopTen Chemically Competent E ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... previously coated with the anti-B55δ antibody (1 hour incubation at 4°C, followed by extensive washes) and Nickel beads (Qiagen) coated with 400 μg of 6XHIS-S67thio-S109A-XeARPP19 ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from enrichment material in technical duplicates (1 ml digestate or 0.25 g soil) using the PowerLyzer™ Soil DNA extraction kit (QIAGEN) with modified bead beating using a MP Biomedicals™ FastPrep®-24 (Thermo Fischer Scientific Inc ...
-
bioRxiv - Molecular Biology 2023Quote: ... The reaction was mixed with an equal volume of chloroform/isoamyl alcohol (24:1) and separated with a phase-lock tube (Qiagen) by centrifugation (14000 rpm ...
-
bioRxiv - Molecular Biology 2023Quote: ... TbFUT1 cKO and TbFUT1 cKO F1-γL262P/WT cells grown under permissive and non-permissive conditions and RNA was extracted from 1 ×107 cells using RNeasy RNA extraction kit (Qiagen). RT-qPCRs were performed using Luna® Universal qPCR Master Mix (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... a single GFP+ or GFP-J-Lat 11.1 cell was sorted directly into each well of a 96-well PCR plate containing the pre-amplification mastermix consisting of 1 μL One-step RT-PCR enzyme (QIAGEN), 5 μL 5× One-step RT-PCR buffer (QIAGEN) ...
-
bioRxiv - Cancer Biology 2023Quote: ... a ∼20 mg chunk of frozen lung tissue was collected using a scalpel and placed in 1 mL RLT buffer (Qiagen) with 1:100 β-mercaptoethanol in a Precellys silicone bead dissociation tube (Bertin-Corp) ...
-
bioRxiv - Biochemistry 2023Quote: Total RNA was isolated and purified from cultured cells using a standard commercial RNA prep kit (#48500, Norgen) and 1 μg of RNA was reverse transcribed to cDNA using a cDNA synthesis kit (#205314, Qiagen). 10 ng of cDNA was used for quantitative PCR by SYBR Green ...
-
bioRxiv - Plant Biology 2023Quote: Frozen tissue was ground into a fine powder using a ⅛” steel ball bearing with 1 min shaking at 25 Hz in a TissueLyser II (Qiagen). Total RNA was extracted from finely ground tissue using TRI reagent (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... reverse transcription of RNA extracted from OECM-1 cells transfected with miRNA mimics and SC control was carried out using the Quantitect Reverse Transcription Kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was isolated from 1 million cells of each cell line using the QIAamp®DNA Micro Kit (QIAGEN) following the manufacturer’s guidelines ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was isolated from DLD-1 cells ectopically expressing EPHB1 mutants using the RNeasy Plus Mini Kit (Qiagen, Germany). First strand cDNA synthesis was conducted with the RevertAid H-minus First Strand cDNA synthesis kit (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Prior to RNA extraction individuals were homogenized in 200 μl homogenization buffer including 4 μl 1-Thioglycerol using a TissueLyser II (Qiagen) with a mixture of five 1 mm zirconia (BioSpec Products ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... CCR6int and CCR6high subsets of CD4+ T cells were used for isolating RNA without and with prior activation with 20 ng/ml PMA and 1 mM ionomycin for 3 h at 37°C under 5% CO2 using RNeasy Mini Kit (Qiagen) and gene expression levels were determined using Illumina Human WG6 Expression BeadChip Version 3 arrays (Illumina Inc. ...
-
bioRxiv - Immunology 2023Quote: Total RNA was extracted from frozen tissue samples using ceramic beads (Precellys homogenizer, 1× 20 s) in RLT buffer (RNeasy Mini kit, Qiagen) supplemented with 1%ß-mercaptoethanol ...
-
bioRxiv - Immunology 2023Quote: ... Cells were stimulated with LPS (1 μg/ml) for 6 hours at 37°C followed by RNA isolation using a RNeasy Kit (QIAGEN). Extracted RNA was converted to cDNA with an iScript cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Neuroscience 2023Quote: ... brain hemispheres were homogenized in freshly prepared lysis buffer (0.6 ml per 30 mg of brain tissue) containing 1% β-mercaptoethanol using a TissueRuptor homogenizer (Qiagen).
-
bioRxiv - Synthetic Biology 2023Quote: ... The organs were weighed and lysed in 1 mL Triton X-100 solution (0.1% in PBS) using a TissueLyser II (QIAGEN, Germany) according to the manufacturer protocol ...
-
Analysis of spike protein variants evolved in a novel mouse model of persistent SARS-CoV-2 infectionbioRxiv - Microbiology 2023Quote: ... 45 cycles at 95° for 15 sec and 60° for 1 min were performed in the Rotor-Gene Q real-time PCR cycler (Qiagen). The numbers of copies of the RdRP gene in the samples were calculated using an RdRP cDNA standard curve.
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Plant Biology 2023Quote: ... Genomic DNA libraries were created using genomic DNA extracted from 2-week old Col-0 seedlings grown on ½ Murashige and Skoog media supplemented with 1% sucrose with DNeasy Plant Mini kit (Qiagen). Plasmids containing the proteins of interest in the pIX-HALO backbone were ordered from ABRC ...
-
bioRxiv - Genomics 2023Quote: ... The bead-bound gDNA was isothermally amplified for 3 hours at 30 °C then 10 minutes at 65 °C using a miniaturised (1/5 vols) Repli-g Single-Cell assay (Qiagen). The amplified gDNA was cleaned up with 0.8 × vols Ampure XP and 80 % ethanol ...
-
bioRxiv - Microbiology 2023Quote: ... Illumina sequencing-compatible Unique Dual Index (UDI) adapters were ligated onto the pools using the QIAseq 1-step amplicon library kit (Qiagen). Library QC was performed using Qubit and Tapestation and sequenced on the Illumina MiSeq platform to generate 2×250bp reads.
-
bioRxiv - Molecular Biology 2023Quote: cDNA was produced from 1 μg of total RNA (final cDNA concentration 5 ng/ml) using QuantiTech Reverse Transcription kit (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... and purified His-Cdk9 (1 μM) in total volume of 300 μl were added to 50 μl of Ni-NTA agarose (Qiagen) equilibrated with binding buffer 1 (25 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Genetics 2023Quote: ... Cells were washed three times with ice-cold PBS and lysed at room temperature with 1 ml/well QIAzol lysis reagent (QIAGEN). Lysates were incubated at room temperature for 5 min and homogenised by pipetting up and down ...
-
bioRxiv - Microbiology 2023Quote: Total genomic DNA was extracted from HSV-1 ANG and ANG path virions using the QiaAmp Mini DNA Kit (Qiagen). Full-length nucleotide sequences of UL44 ...
-
bioRxiv - Genetics 2023Quote: ... Amplicons spanning the gRNA target sites were amplified from 1 μL of purified gDNA using HotStar PCR Master Mix (Qiagen). Half of each reaction was run on a 1.5% agarose gel ...
-
bioRxiv - Bioengineering 2023Quote: ... The supernatants were then supplemented with 20 mM imidazole and then loaded onto 1 mL bed volume of Ni-NTA agarose beads (Qiagen) that were pre-washed with 5 column volumes of 1x PBS ...
-
bioRxiv - Microbiology 2023Quote: ... DNA extraction aimed at producing fragments adequate for long-read sequencing and followed either of two methods: 1) DNeasy PowerSoil Kit (Qiagen) without bead-beating and vortexing steps ...
-
bioRxiv - Genetics 2023Quote: ... To prepare the protein column we loaded 2 mL (1 mL column volume) of Nickel NTA resin onto the 5 mL Polypropylene columns from Qiagen and the resin buffer was allowed to drain ...
-
bioRxiv - Microbiology 2023Quote: ... pHIVec2.luc reporter plasmid and psPAX2 packaging plasmid (catalog number 11348, NIH AIDS Reagent Program) in a ratio of 1:6:3 using either Effectene (Qiagen) or calcium phosphate ...
-
bioRxiv - Genomics 2023Quote: ... tubes were incubated at 56°C for 1 hour followed by addition of 2ul of RNAse A (100mg/ml, QIAGEN) to 1ml of saliva sample and incubated at room temperature for 5 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... Metagenomic sequencing libraries were constructed from extracted DNA samples with 10 μL (1/5 volume) reactions using the QIAseq FX DNA Library Kit (QIAGEN). Each metagenomic sequencing library was sequenced using the Illumina NextSeq 2000 System 2 x 150 bp configuration.
-
bioRxiv - Microbiology 2023Quote: ... round 1 and 3 virus infections of GeCKO-A549 cells using the midi gDNA extraction kit (Qiagen, Germantown, MD, USA). The sgRNA’s DNA copies were PCR amplified from the extracted gDNAs for next generation sequencing (Fig 1) ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA (2 μg per sample) extracted from 1×106 BSCs was performed using the Qiagen RNA RNeasy Kit (Cat#74104, Qiagen) followed by library preparation with the Illumina TruSeq V2 Kit (Cat#20020594 ...
-
bioRxiv - Biochemistry 2023Quote: ... about 100 mg of tissue samples were homogenised in 1 mL of TRI reagent at room temperature using a tissue lyser (Qiagen). The homogenised samples were transferred to fresh microcentrifuge tubes for RNA isolation ...
-
bioRxiv - Biochemistry 2023Quote: ... HBEC5i cells with treated with either non-specific siRNA or Flvcr2 siRNA were harvested and kept in 1 mL TRI reagent (Qiagen).
-
bioRxiv - Bioengineering 2023Quote: ... the cells were pelleted at 15000 g at 4 °C for 30 minutes and the supernatant was supplemented with 20 mM of imidazole before loading onto 1 mL bed volume of Ni-NTA agarose beads (Qiagen) pre-washed with 5 column volumes of 1x TBS (pH 7.3) ...
-
bioRxiv - Bioengineering 2023Quote: ... Lysate supplemented with 20 mM imidazole was cleared by centrifugation at 15000 g at 4 °C for 30 minutes and the supernatant was then loaded onto 1 mL bed volume of Ni-NTA agarose beads (Qiagen) pre-washed with 5 column volumes of 1x TBS (pH 7.3) ...
-
bioRxiv - Microbiology 2023Quote: ... Illumina sequencing-compatible Combinatorial Dual Index (CDI) adapters were ligated onto pooled amplicons using the QIAseq 1-step amplicon library kit (Qiagen). Library QC was performed using Qubit and Tapestation and sequenced on Illumina MiSeq platform to generate 2×250bp reads ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were incubated at 37 °C with agitation for six hours after which time 1 mL cell pellets were treated with RNAprotect (Qiagen). Cell pellets were washed in 0.5 mL PBS pH 7.4 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5 µl of each PCR product was run in a 1% agarose gel and the remaining 35 µls were purified using the QIAquick PCR Purification Kit (Qiagen) before being sent for sequencing (sequencing primers ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were washed twice with 1× PBS and total DNA was extracted at 6 hpi with a DNeasy Blood/Tissue DNA mini kit (Qiagen) and total DNA yield was measured by a nanodrop spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: Infected whole eyes were homogenized in 1 mL of sterile PBS using a Retsch Mixer Mill MM300 (Qiagen, Valencia, CA) at 33 Hz for 4 min ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were separated on a 1% agarose gel and bands were excised using a QIAquick gel extraction kit (Qiagen). The purified PCR bands were cloned using the NEB PCR cloning kit following manufacturer’s instructions and transformed colonies were screened using colony PCR ...
-
bioRxiv - Immunology 2024Quote: ... semimature SP thymocytes were isolated on BD FACSAria II and BD FACSAria Fusion cell sorters directly into RLT + 1% beta-mercaptoethanol (BME) buffer (Qiagen). Libraries were generated by the Emory Integrated Genomics Core (EIGC ...
-
bioRxiv - Microbiology 2024Quote: ... A 1 μg of total RNA of each sample was reverse-transcribed to cDNA using RT2 first strand kit (Qiagen) according to manufacturer’s protocol ...