Labshake search
Citations for Qiagen :
1551 - 1600 of 1696 citations for 2 Chloro 3 6 chlorohexanoyl pyridine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... 20 µM of Illumina primers and 1:2000 dilution of 2 ng/µl library on Rotor-Gene Q machines (Qiagen), program and primer sequences are in Table) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... For DNA extraction approximately 2 mm3 of wing muscle tissue was removed from the thorax and processed using DNeasy Blood and Tissue Kits (Qiagen) following standard manufacture protocols ...
-
bioRxiv - Plant Biology 2020Quote: ... a 2 ml subsample of the coarse powder was ground to a fine powder using a Qiagen TissueLyser (Qiagen, Germantown, MD). Finely powdered leaf tissue was then sent to Midwest Laboratories (Omaha ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant containing solubilized protein was filtered using a 0.22 μM nylon membrane filter and incubated with 2 ml of nickel-nitrilotriacetic acid (Ni-NTA) resin (Qiagen, Germantown, MD) at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Real-time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18S rRNA gene was used as internal control for normalization ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Cell Biology 2022Quote: ... RNA was extracted from infected or mock-treated Caco-2 cells using the Qiagen RNAeasy Plus Extraction Kit (Qiagen, Hilden, Germany). For quantifying the SARS-CoV-2 genome abundance in mock and infected samples ...
-
bioRxiv - Genomics 2020Quote: ... SARS-CoV-2 viruses were purified from the clinical samples by using QIAamp Viral RNA Mini Kit (Qiagen, Cat. No. 52906). The preparations were analyzed by real-time RT–PCR testing for the determination of viral titers of SARS-CoV-2 by standard curve analysis ...
-
bioRxiv - Molecular Biology 2020Quote: ... mantle (Ma) and gonad (Go) tissues were collected and individually transferred to 2-mL tubes containing RNA later (QIAGEN, Maryland, USA) separately ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... was ground to small pieces by one steel ball (Ø 4 mm) in a 2 ml Eppendorf tube with Tissue Lyzer II (Qiagen, Hilden ...
-
ST6GAL1-mediated heterogeneity in sialic acid levels potentiates invasion of breast cancer epitheliabioRxiv - Cancer Biology 2020Quote: ... Real time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18 S rRNA gene was used as internal control for normalization ...
-
bioRxiv - Biochemistry 2020Quote: ... 4°C) an applied to a 2 ml Ni-NTA immobilised metal affinity chromatography (IMAC) gravity flow column (QIAGEN, Hilden, Germany). Columns were washed in 10 column volumes (CV ...
-
bioRxiv - Microbiology 2020Quote: ... Each 10 μL uPCR reaction contained 2 μL of DNA template with 1x QuantiTect Multiplex PCR No ROX mastermix (Qiagen™), 0.4 μM each primer ...
-
bioRxiv - Microbiology 2021Quote: ... pCDNA-SARC-CoV-2 Wuhan-Hu-1 P681H S plasmid was then extracted using the QIAprep Spin Miniprep Kit (Qiagen N.V.) and Sanger sequencing was used to confirm incorporation of the mutation.
-
bioRxiv - Microbiology 2021Quote: A total of 2 x 105 Vero E6 or HEK293ACE-2 cells were seeded 24 hours before transfection with one of the following siRNAs pools (Qiagen SMARTpool): siSTT3A (#GS3703) ...
-
bioRxiv - Cancer Biology 2021Quote: ... or CRTC3 or control sgRNA (Supplementary Table 2) were transfected into 293FT cells together with packaging plasmids pMD2.G and pSPAX2 using Effectene transfection reagent (Qiagen #301425). The viral supernatants were collected at 48 ...
-
bioRxiv - Genomics 2021Quote: ... The samples were then transferred to RNeasy spin columns and 2 ml collection tubes from an RNeasy Mini Kit (Qiagen, 74104) and centrifuged at 13,000 rpm for 15 sec ...
-
bioRxiv - Genomics 2022Quote: Buccal swab samples were placed in 2 mL Eppendorf tubes and were extracted using a modified version of the DNeasy® Blood and Tissue Kit (Qiagen). In each tube were added 380 μL of ATL Buffer and 20 μL of Proteinase K (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... The clinical Samples (cervical smear) for the HPV DNA test were processed using HPV Test Hybrid Capture® 2 protocol (QIAGEN). Samples with relative light units (RLU ...
-
bioRxiv - Immunology 2020Quote: RNA was isolated from a minimum of 2 × 106 sorted MDSCs or nonMDSCs using an RNAeasy Mini Kit (Qiagen, Germantown, MD). RNA sequencing was performed by GENEWIZ (South Palinfield ...
-
bioRxiv - Genomics 2022Quote: The second lobe of lung or trachea was immersed in 1 mL PBS in a 2 mL Micro Centrifuge Tube (Fisherbrand, 14-666-315) containing one stainless steel bead (5 mm, QIAGEN, 1026563) immediately after dissecting the SARS-CoV-2 infected mouse or hamster ...
-
bioRxiv - Genomics 2022Quote: ... Trachea was dissected and immersed in 1 mL PBS in a 2 mL microcentrifuge tube (Fisherbrand, 14-666-315) containing one stainless steel bead (QIAGEN, 69989). After the homogenization ...
-
bioRxiv - Genomics 2022Quote: ... Day 145) for n=4 clams for each treatment (Figure 2) using the Qiagen DNeasy Blood and Tissue Kit (Qiagen USA) according to manufacturer’s instructions with slight modifications ...
-
bioRxiv - Epidemiology 2020Quote: ... Then a steel ball was added and samples were crushed twice during 2 min at 30 Hz/s with the Tissue Lyzer (Qiagen, Germany). 450 µL of fresh PBS 1X were added to the samples ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and ∼55 mg of total protein in CFE was incubated for 60 min at 4 °C with 2 mL of Ni-NTA agarose (QIAGEN, Germany) equilibrated with purification buffer A ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA was isolated from 2 g of homogenized material from frozen needles using the DNeasy Plant Maxi Kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... For SARS-CoV-2 antigen detection the blots were incubated with 1:2000 Anti-His mouse monoclonal primary antibody (Qiagen, #34660) and then incubated with 1:10000 peroxidase labelled anti-mouse IgG secondary antibody (GE Healthcare) ...
-
bioRxiv - Neuroscience 2021Quote: ... Amplicons were separated on a 1-2% agarose gel and appropriate bands were excised and isolated using a gel extraction kit (Qiagen, USA). These fragments were inserted into the pcDNA3.1-based plasmid or cFUGW lentivirus vector using the T4 ligase (New England Biolabs ...
-
bioRxiv - Developmental Biology 2020Quote: ... at and after 32-cell stage were extracted using Animal Tissue Direct PCR kit (FOREGENE) and those (~200) of unfertilized eggs and 2-cell embryos were purified using DNeasy® Blood & Tissue Kit (Qiagen). DNA fragments flanking target sites were amplified using primers listed in Supplementary Table S3 ...
-
bioRxiv - Cell Biology 2020Quote: Isolated Chromatin was digested with 1% proteinase K for 2 hrs at 60 °C with 300 rpm and was subsequently purified by using QIAquick® Nucleotide Removal Kit (28306, Qiagen) according to the manufactory’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Transient transfections were carried out using just subconfluent cultures in 35 mm plates using DNA in the range of 0.3-2 µg/culture and the Polyfect reagent (Qiagen, Germantown, MD) and the manufacturer’s protocol (with 10 µl Polyfect reagent per 35 mm plate).
-
bioRxiv - Genomics 2020Quote: HACs from six non-OA donors (Supplementary File 2) seeded individually at 30,000 cells/cm2 in triplicate were transfected (HiPerfect; Qiagen, Manchester, UK) with 100 nM ASO (Eurogentec ...
-
bioRxiv - Microbiology 2020Quote: ... Real-time PCR was monitored on Rotor-Gene® Q-Pure Detection System (Software Ver. 2, Qiagen Inc., Valencia, CA, USA) and performed using QuantiFast SYBR® Green PCR Master Mix (Qiagen) ...
-
bioRxiv - Microbiology 2020Quote: ... or remaining mosquito bodies were collected separately in a 2ml Eppendorf Safe Lock tube with 250μl DMEM (2% FBS, 1% Sodium Pyruvate) with 25 mg/ml Amphotericin B and a stainless steel bead (Qiagen, Hilden, Germany). Samples were stored at −80°C.
-
bioRxiv - Microbiology 2020Quote: ... and then with (2) 15 µl Proteinase K [>600 mA/ml] and 5 µl Rnase A [100 mg/ml] (Qiagen, Germany) for 5min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were centrifuged at 5000 g for 2 hours at 4 °C and the pellet was collected for DNA extraction with a DNeasy PowerSoil kit (Qiagen, Germany). The sediment from Lime Blue was collected with a freeze core (modified from Stocker and Williams ...
-
bioRxiv - Biochemistry 2022Quote: ... Transient transfections were carried out using just subconfluent cultures in 35 mm plates using DNA in the range of 0.3-2 µg/culture and the Polyfect reagent (Qiagen, Germantown, MD) and the manufacturer’s protocol (with 10 µl Polyfect reagent per 35 mm plate).
-
bioRxiv - Evolutionary Biology 2022Quote: ... log-phase cells in the range of 1–2 × 108 cells using the Qiagen DNeasy® Blood and Tissue kit (Qiagen). We resuspended the genomic DNA in 10 mM Tris-HCl pH 8.5 and stored it at 4° until submission to the McDonnell Genome Institute at Washington University in St ...
-
bioRxiv - Plant Biology 2022Quote: ... The frozen plant material was ground to a fine powder using 2 mm Ø glass beads (Huberlab) and a TissueLyser (Qiagen) for 1 min at maximum frequency ...
-
bioRxiv - Microbiology 2022Quote: ... hACE2 expression or SARS-CoV-2 nucleocapsid (N) gene in individual mouse organs was determined using QuantiNova SYBR Green PCR kit (Qiagen #208052) in combination of 500 nM of hACE2 gene specific primer set (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 viriants S and point-mutated pseudovirus were extracted using the QIAamp Viral RNA Mini Kit (QIAGEN, Cat#52906), and served as template for reverse transcription using the TransScript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR reagent (TransGen Biotech ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK-beta cells were transiently transfected with WT or variant NaV1.2 (2 µg) using Qiagen SuperFect reagent (Qiagen, Valencia, CA, U.S.A.).
-
bioRxiv - Neuroscience 2022Quote: Dissected cortex and striatum were homogenized 2 x 1min at 25 Hz in 750μL of QIAzol Lysis Reagent (Qiagen, Valencia, CA) with TissueLyser (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: ... Complementary DNA (cDNA) was subsequently generated using 2 μg of total RNA and the miScript II Reverse Transcription (RT) Kit (Qiagen, Australia), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... c-Cbl (s2476) (Table S1) or a negative control siRNA (Silencer™ Negative Control No. 2 siRNA) using HiPerfect Transfection Reagent (Qiagen) per manufacturers’ instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Exosomal miRNAs were profiled using Human Serum/Plasma miRCURY LNA miRNA PCR array (Qiagen, #YAHS-106Y, Plate Format: 2 × 96-well).
-
bioRxiv - Immunology 2022Quote: ... 350 µL of aqueous phase was transferred into a 2 mL reaction tube and subjected to the QIAcube (QIAGEN, Hilden, Germany) for RNA isolation ...
-
bioRxiv - Microbiology 2024Quote: Total RNA was extracted from each 2 g of bulk and rhizosphere soils of the pepper plants using a RNeasy PowerSoil Total RNA Kit (Qiagen, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted from OSU-CLL cells (1.5e6 cells/mL) treated with DMSO or SpiD3 (1, 2 μM; 4 h) using the miRNeasy Mini Kit (Qiagen; Hilden, Germany) per manufacturer instructions and processed using the Universal Plus mRNA-Seq with NuQuant kit (Tecan ...
-
bioRxiv - Bioengineering 2024Quote: ... posterior eye cups (PECs) were separated and collected in 2 mL reinforced tubes (SPEX Sample Prep) containing 5 mM stainless steel beads (Qiagen, LLC).