Labshake search
Citations for Qiagen :
1501 - 1550 of 10000+ citations for Mouse WAP kazal immunoglobulin kunitz and NTR domain containing protein 2 WFIKKN2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... to perform RT² Profiler™ PCR Array Mouse Hypoxia Signaling Pathway (Qiagen) real-time PCR in Stratagene MX3000p qPCR system under these cycling conditions ...
-
bioRxiv - Genetics 2021Quote: ... Hrh1 amplicons from each mouse strain were gel purified (Qiagen Cat# 28115) and DNA sequencing reactions were performed with the BigDye terminator cycle sequencing kit (Applied Biosystems ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... against Gαs subunit and mouse poly-His antibody (cat. no. 34660, QIAGEN) against His tags ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA against 3’UTR sequence of mouse Alr were purchased from Qiagen. siRNAs were transfected into HEK293 or MEF using Dharmafect 1 Transfection Reagent (Dharmacon) ...
-
bioRxiv - Molecular Biology 2022Quote: ... were transfected into mouse calvarial osteoblasts using the Effectene transfection reagent (Qiagen). After 48 hours ...
-
bioRxiv - Biochemistry 2021Quote: ... against Gαs subunit and mouse poly-His antibody (cat. no. 34660, QIAGEN) against His tag ...
-
bioRxiv - Biochemistry 2021Quote: ... against Gαs subunit and mouse penta-His antibody (cat. no. 34660, QIAGEN) against His tags ...
-
bioRxiv - Immunology 2019Quote: ... The following mouse primer sets were used from Qiagen (Valencia, CA, USA): TBP (PPM03560F ...
-
bioRxiv - Cell Biology 2021Quote: siRNA for mouse VHL (Flexitube Gene Solution GS22346) was obtained from Qiagen. AllStars negative control siRNA ...
-
bioRxiv - Immunology 2020Quote: A RT2 profiler array for mouse inflammatory cytokines and receptors (Qiagen, USA) was used according to manufacturer recommendations to measure the expression of 84 inflammatory genes (Table S1) ...
-
bioRxiv - Microbiology 2022Quote: ... and immunoblotted using a mouse monoclonal antibody against Strep-tag (Qiagen, 34850). Alkaline phosphatase conjugated to anti-mouse IgG (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: Mouse antibody genes were amplified using HotstarTaq DNA polymerase (Qiagen Cat # 203209) with the primer sets specific for the IghIOMAiGL and IgkIOMAiGL transgenes ...
-
bioRxiv - Biochemistry 2023Quote: ... a conjugate of mouse monoclonal penta-His antibody and horseradish peroxidase (Qiagen) was used ...
-
bioRxiv - Biochemistry 2023Quote: ... and mouse anti-Phospho-Serine Q5 (catalogue number: 37430) was from Qiagen. Horseradish peroxidase-conjugated secondary antibodies against rabbit (catalogue number ...
-
bioRxiv - Genetics 2023Quote: Mouse tissues were either homogenized using QIAzol lysis reagent (Qiagen, Hilden, Germany) in a Tissue Lyser instrument (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: ... A mouse Yy1-specific siRNA or the AllStars Negative Control siRNA (Qiagen) was co-transfected with an L1 promoter reporter plasmid using Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... tumefaciens culture was added to 2 ml RNAprotect Bacteria Reagent (Qiagen) and RNA was isolated using RNeasy columns (Qiagen) ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Microbiology 2021Quote: ... In replicates 1 and 2 a Universal extraction robot (Qiagen, Germany) and associated nucleic acid extraction (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Microbiology 2024Quote: ... cleared lysates were incubated with 2 mL Ni-NTA agarose (Qiagen) on a rotator for 1 hour at 4°C ...
-
bioRxiv - Immunology 2020Quote: ... total RNA was isolated using RNeasy Mini Kit or Micro Kit (Qiagen). Reverse transcription was performed using M-MLV Reverse Transcriptase and random primers following manufacturer’s instructions (Thermo Fisher Scientific) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... RNA was extracted using a commercial kit (RNseasy Plant Mini Kit, Qiagen), followed by cDNA synthesis (iSCRIPT ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using standard column-based purification kit (QIAGEN RNeasy Kit, Cat. No. 74004). DNase treatment was applied during the purification to remove any potential DNA contamination ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was extracted using the RNeasy Mini Kit extraction kit (QIAGEN). RNA-less and reverse transcriptase-less reactions were used as controls ...
-
bioRxiv - Cancer Biology 2021Quote: ... purified with QIAquick Gel Extraction kit or QIAquick PCR Purification kit (Qiagen), ligated using T4 DNA Ligase (New England BioLabs) ...
-
bioRxiv - Genetics 2020Quote: ... Plasmids were prepared using silica-membrane based kit (Plasmid Miniprep Kit, Qiagen) following the manufacturer’s instructions and quantified using Nanodrop Spectrophotometer ...
-
bioRxiv - Genetics 2020Quote: ... according to the DNeasy Blood & Tissue kit and DNeasy Micro kit (QIAGEN). Total RNA was extracted from pelleted cells using the Rneasy Mini kit (QIAGEN ...
-
bioRxiv - Microbiology 2019Quote: ... using viral RNA isolation kit (QIAmp Viral RNA Mini Kit Qiagen, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... QIAprep Spin miniprep kit and QIAquick gel extraction kit (Qiagen, Hilden, Germany) were used according to the manufacturer’s protocol to isolate plasmids and to separate PCR products from agarose gels ...
-
bioRxiv - Biochemistry 2023Quote: ... gel extraction kit and PCR clean-up kit was obtained from Qiagen, Hilden ...
-
bioRxiv - Biochemistry 2022Quote: ... QIAGEN Plasmid Maxi Kits and QIAprep Spin Miniprep Kit were from QIAGEN. Zymo PUREII Plasmid Midiprep kit (D4200 ...
-
bioRxiv - Molecular Biology 2023Quote: ... plasmid DNA preparation (QIAprep Spin MiniPrep Kit and Plasmid Midi Kit, Qiagen) and gel electrophoresis were performed according to the manufacturer’s instructions or using standard protocols (29) ...
-
bioRxiv - Cell Biology 2023Quote: DNA was extracted using a commercial kit (DNeasy Blood & Tissue kit, Qiagen). For cDNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... and extracted with Jetgene mini prep kit (QIAprep Spin Miniprep Kit, QIAGEN). The correctness of constructions was verified by sequencing (Eurofins) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Qiaspin Miniprep Kit (Qiagen) and Monarch PCR & DNA Cleanup Kit (NEB ...