Labshake search
Citations for Qiagen :
1501 - 1550 of 4234 citations for 6 chloro 2 N 2 N diethyl 4 N propan 2 yl 1 3 5 triazine 2 4 diamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... matching a sequence in intron 22 of the HTT gene (5’-TAATACGTAAGTGTCACAA-3’, custom synthesized by Qiagen) was delivered by intracerebroventricular (ICV ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA was extracted from pools of 3-5 second leaves using the Plant RNAeasy kit (Qiagen) using manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... Tsg101 (Hs_TSG101_6) target sequence: 5′-CAG TTT ATC ATT CAA GTG TAA -3′ (QIAGEN, cat. no. SI02655184); Alix (Hs_PDCD6IP_5 ...
-
bioRxiv - Bioengineering 2024Quote: ... Alix (Hs_PDCD6IP_5) target sequence: 5′-AAG AGC TGT GTG TTG TTC AAT -3′ (QIAGEN, cat. no. SI02655345); Negative Control siRNA ...
-
bioRxiv - Molecular Biology 2022Quote: Two independent siRNAs targeting YBX1 (Hs_YBX1-1 and Hs_YBX1-6 FlexiTube siRNA, Qiagen) and a non-targeting negative control siRNA (AllStars ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from frozen mouse liver (20-25 mg) and HepG2 cells (5-6 million) using the AllPrep DNA/RNA Mini Kit (QIAGEN) according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2020Quote: ... DNA was isolated using Qiagen MagAttract PowerMicrobiome kit DNA/RNA kit (Qiagen, catalog no. 27500-4-EP) on the EpMotion 5075 (Eppendorf ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted from pure cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen 10196-4) or DNeasy Blood and Tissue Kit (Qiagen 69504 ...
-
bioRxiv - Microbiology 2020Quote: Total RNA was extracted from 4 mg of ground lyophilized material using the RNeasy Midi kit (Qiagen). A DNase treatment (Ambion ...
-
bioRxiv - Cancer Biology 2022Quote: Cell pellets or pieces of xenografts were lysed in 4% SDS buffer using a QIAshredder (Qiagen, 79654). See Supplementary Table S1 for antibodies used ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was isolated from 4×107 KPC cells using the Blood & Cell Culture DNA Maxi Kit (Qiagen). NGS libraries were prepared using the following primers:
-
bioRxiv - Microbiology 2020Quote: ... RNA extraction was performed from homogenate of 4 mg of lung tissue with RNeasy Mini Kit (Qiagen), or 50µl of serum using the NucleoSpin kit (Macherey-Nagel) ...
-
bioRxiv - Immunology 2022Quote: ... 97-mer shRNA oligonucleotides were synthesized (IDT) and 4 picomoles were amplified with HotStarTaq polymerase (Qiagen#203207) using the primers miR-E-fw (5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The plates were coated with 100 μL of 4 μg/mL murine anti-His mAb (Qiagen, #34660), and after blocking ...
-
bioRxiv - Pathology 2021Quote: ... at 4°C and total RNA was extracted with the RNeasy Midi kit (Qiagen, Santa Clarita, CA). Mouse Genome 430A 2.0 arrays (Affymetrix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Samples were kept at 4° for two days before extracting DNA using the DNeasy PowerSoil Kit (Qiagen). We also obtained DNA extracted from ...
-
bioRxiv - Genomics 2021Quote: ... sativa seedlings (∼1.5 weeks) and mature leaves (∼4 weeks) using the DNeasy Plant Mini kit (Qiagen #69104) and diluted to 5 ng/μl ...
-
bioRxiv - Immunology 2020Quote: 4 matched pairs of Treg and MulTreg were expanded and RNA extracted (RNeasy RNA extraction kit, Qiagen). cDNA was then produced (SMART cDNA synthesis kit ...
-
bioRxiv - Developmental Biology 2020Quote: ... 565 E.coli colonies per guide ratio (>500x coverage) was used to process the 4 Maxi-Prep (Qiagen) reactions ...
-
bioRxiv - Biochemistry 2022Quote: ... 4°) and plasmids were extracted from the cell pallets using QIAprep Spin Miniprep kit (Qiagen, CA, USA). The sequences of the inserts were confirmed by Sanger sequencing (ACGT Inc ...
-
bioRxiv - Immunology 2022Quote: ... After mechanical disruption by shaking at 25/s over 4 min with metal beads (TissueLyser II, Qiagen), two 250 μL aliquots of the homogenate were stored at -80°C for viral plaque titration ...
-
bioRxiv - Plant Biology 2022Quote: ... the clear supernatant was incubated for 4 h with 1.5 ml Ni-NTA agarose (Qiagen, Hilden, Germany) previously washed with 6 ml of distilled H2O and equilibrated with 6 ml of binding buffer (150 mM NaCl ...
-
bioRxiv - Microbiology 2022Quote: ... Four wells were then harvested at the appropriate growth stage and combined with 4 mL RNAprotect (Qiagen) to generate each replicate ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was extracted from pure cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen 10196-4) or DNeasy Blood and Tissue Kit (Qiagen 69504 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cleared lysate was applied to 4 ml bed volume Ni-NTA Agarose beads (Qiagen, cat. No. 30210) for 1 hour ...
-
bioRxiv - Molecular Biology 2024Quote: ... Labchip analysis was performed to assess the size of small RNAs according manufacturer’s instructions (PerkinElmer).The Reverse transcription was performed on 4 ng RNA using miRCURY® LNA® RT Kit (Qiagen). Real-time quantitative PCR was performed on 40 pg cDNA using specific primers (Supplementary Table 1 ...
-
bioRxiv - Microbiology 2023Quote: ... 4 ml of field-saturated peat were added to 2.5 volumes of Lifeguard buffer (Qiagen, Maryland, USA), transferred out of the field on ice in a cooler ...
-
bioRxiv - Biochemistry 2023Quote: ... The harvested cells of TonAmyGT and Chimera 4 were re-sususpended with non-denaturing lysis buffer (Qiagen) and 0.2 % of Sarcosyl and kept overnight for re-suspension ...
-
bioRxiv - Microbiology 2023Quote: ... aureus and 4 food-derived Staphylococcus bacteria were extracted using the DNeasy 96 Blood & Tissue kit (Qiagen). For sequencing analysis ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was collected 4 days post lentiviral shRNA transduction using RNeasy Plus Mini Kit (Qiagen #74134). Lentiviral transduction and RNA extraction were performed in triplicates ...
-
bioRxiv - Biochemistry 2023Quote: ... Affinity chromatography was carried out at 4°C with a Ni-NTA sepharose column (Qiagen, Hilden, Germany). The column was pre-equilibrated with 50 mM NaH2PO4-buffer pH 7.6 ...
-
bioRxiv - Microbiology 2024Quote: ... 4 °C) and the supernatant was loaded onto a Ni-nitrilotriacetic acid (NTA) column (Qiagen, Hilden, Germany). After a washing step (6 M urea ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Cell Biology 2019Quote: ... and SHARPIN siRNA (5’-GCUAGUAAUUAAAGACACAd(TT)-3’) and the scramble Allstars negative control siRNA were ordered from QIAGEN. Gene silencing was performed using siRNA oligonucleotides and Lipofectamine RNAiMax reagent (13778150 ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Developmental Biology 2019Quote: ... The products from 3 to 5 PCR reactions were pooled before purifying the DNA on MinElute columns (Qiagen).
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Neuroscience 2023Quote: ... LNA-CTG and the control scrambled LNA-modified sequence (LNA-SCB) 5′-GTGTAACACGTCTATACGCCCA-3′ were obtained from Qiagen as previously described in Rue et al 34
-
bioRxiv - Microbiology 2024Quote: ... The DNA of the 20 Jan and 3 Mar 2021 samples (1/3 pellet) was extracted with the DNeasy UltraClean Microbial Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were lysed (1.28 M sucrose, 40 mM Tris-HCl [pH 7.5], 20 mM MgCl2, and 4% Triton X-100; Qiagen) and digested (800 mM guanidine–HCl ...
-
bioRxiv - Genomics 2020Quote: Nucleic acids were isolated from 4 mL of plasma by using a QIAamp cfDNA/RNA kit (Qiagen 55184) following the manufacturer’s protocol ...
-
bioRxiv - Physiology 2021Quote: Liver homogenates were prepared in cold conditions (+4°C) by adding a stainless-steel bead (Qiagen, cat. 69989) and tissue lysis buffer (composition ...
-
bioRxiv - Immunology 2022Quote: ... Total RNA of spleens (4 samples per group) was isolated with the QIAGEN miRNeasy mini extraction kit (QIAGEN) and cDNA was synthesized with the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) ...
-
Deconstructing the role of iron and heme in the structure of healthy human gut microbial communitiesbioRxiv - Microbiology 2022Quote: ... 50 µL of saturated bacterial cultures were extracted using a DNeasy UltraClean 96 Microbial Kit (Qiagen, 10196-4).
-
Deconstructing the role of iron and heme in the structure of healthy human gut microbial communitiesbioRxiv - Microbiology 2022Quote: ... PCR products were individually cleaned up and quantified using the UltraClean 96 PCR Cleanup Kit (Qiagen 12596-4) and the Quant-iT dsDNA High Sensitivity Assay kit (Invitrogen Q33120 ...
-
bioRxiv - Pathology 2020Quote: ... diffracting crystals of P1_102-157 were obtained at 4°C from condition 7 of the Classic kit (Qiagen) containing 0.1 M tri-Sodium citrate pH 5,6 ...
-
bioRxiv - Cell Biology 2019Quote: ... knockdown of KCNB1 expression in human cells was carried out using a mixture of 4 siRNA duplexes (Qiagen; Cat# ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysates were cleared for 30 min at 45,000 × g at 4°C and incubated with 0.6 ml of Ni-NTA agarose beads (Qiagen) per 1 l of expression culture (1 ml beads per 1 l expression culture was used in case of Drosophila BiP ...
-
bioRxiv - Biophysics 2019Quote: ... The SpyTag-(Cpa)4-SpyTag and the HaloTag-SpyCatcher constructs were cloned into the expression plasmid pQE80L (Qiagen). Protein expression and purification was done as described elsewhere36 ...