Labshake search
Citations for Qiagen :
101 - 150 of 1877 citations for Serum amyloid A 2 protein SAA2 Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: RNA was extracted by miRNeasy Serum/Plasma Kit (Qiagen 217184) per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Cell Biology 2021Quote: ... Protein was extracted 48 hours post transfection with All Prep RNA/Protein Kit (Qiagen, USA). Protein concentrations were determined by Lowry assay (Bio-Rad ...
-
YAP promotes cell-autonomous immune responses to tackle intracellular Staphylococcus aureus in vitrobioRxiv - Cell Biology 2022Quote: ... protein extraction was performed using the Allprep RNA/Protein Kit (80404 Qiagen Inc., Hilden, Germany). Proteins (10–20 µg ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein was isolated from powdered tissues using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen). Protein pellets were lysed in HES-SDS buffer (20 mM HEPES [pH 7.4] ...
-
bioRxiv - Microbiology 2023Quote: ... The His-tagged proteins were purified using the QIAexpress Ni-NTA Protein Purification System (Qiagen) with 0.1 M ...
-
bioRxiv - Cancer Biology 2022Quote: ... and protein extraction were performed according to manufacturer instructions (AllPrep DNA/RNA/Protein minikit; Qiagen). Each spin column flowthrough (DNA ...
-
bioRxiv - Cell Biology 2023Quote: Cells were collected for total protein using Qproteome Mammalian Protein Prep Kit (Cat. 37901, Qiagen). Lysates were quantified for protein expression utilizing the WES system (ProteinSimple ...
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... The expressed protein was purified as His-tagged fusion protein using Ni-NTA agarose beads (Qiagen) and analyzed by SDS-PAGE.
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins were purified using the His-tag Protein Purification Kit (Ni-NTA Agarose, QIAGEN GmbH), GST-tag Protein Purification Kit (Glutathione Sepharose ...
-
bioRxiv - Molecular Biology 2023Quote: Total proteins from P5 hippocampi were purified with AllPrep DNA/RNA/Protein Mini Kit (Qiagen, 80004). The protein pellets were then resuspended in 90 μl Buffer ALO (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... exosomal RNA was isolated using the miRNeasy Serum/Plasma Kit (QIAGEN) followed by reverse transcription using the TaqMan MicroRNA Reverse Transcription Kit (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... BALF and serum using QIAamp Viral RNA kit (QIAGEN, Manchester, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: RNA was isolated with the miRNeasy Serum/Plasma Kit (Qiagen, #217184) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... and 20% fetal bovine serum using a TissueLyser (Qiagen, Hidden, Germany). After centrifugation of 12000 rpm for 10 mins ...
-
bioRxiv - Neuroscience 2023Quote: sRNA was isolated using the miRNeasy Serum/Plasma Advanced Kit (Qiagen) according to the manufactureŕs instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and from EVs using the Serum/Plasma miRNeasy Kit (Qiagen, Germany). MiR quantification from all samples was completed with microRNA Qubit (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2020Quote: ... protein was extracted (Qiagen Tissue Lyser) from ∼50 mg frozen liver in tissue lysis buffer 80 ...
-
bioRxiv - Microbiology 2021Quote: ... 200 μL Protein Precipitation Solution (QIAGEN) was added ...
-
bioRxiv - Microbiology 2023Quote: ... and The Protein Complex Suite (Qiagen). One microliter of 4.6 mg/ml protein sample suspended in crystallization buffer (25 mM Tris-HCl ...
-
bioRxiv - Cancer Biology 2023Quote: Advanced Protein Purification buffer (APP; Qiagen): the APP buffer contains zinc chloride to precipitate protein at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... total RNA and proteins were recovered by using the Allprep DNA/RNA/Protein Mini Kit (Qiagen 80004). The efficiency of Cre-induced recombination in Appflox/flox mice was verified by PCR with primers F ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein and RNA extraction was done using Qiagen AllPrep DNA/RNA/Protein isolation kit (Qiagen Inc, USA). RNA purity was confirmed with 260/280 OD ratio using Nanodrop reader (Thermo Scientific ...
-
bioRxiv - Bioengineering 2022Quote: ... some samples were lysed for total protein extraction using Qproteome Mammalian Protein Prep Kit (Qiagen, Hilden, Germany). Western blot was done using capillary electrophoresis based system Wes™ (ProteinSimple ...
-
bioRxiv - Biochemistry 2024Quote: ... co-expressing lambda protein phosphatase and purified with the QIAexpress Ni-NTA Protein Purification System (Qiagen, 30210) according to the manufacturers protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Total RNA was isolated from PBC using miRNeasy serum/plasma kit (Qiagen) with 700 μL QIAzol Lysis buffer and 140 μL chloroform according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... To sequence the envelope from serum virus we isolated viral RNA (Qiagen), synthesized cDNA ...
-
bioRxiv - Genomics 2021Quote: ... RNA from pEV was isolated using the miRNeasy serum/plasma kit (QIAgen) according to the manufacturers’ protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasma miRNAs were isolated using the miRNeasy Serum/Plasma Advanced Kit (Qiagen) and retrotranscribed by the miRCURY LNA RT kit (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: ... Small RNA content was isolated using the miRNeasy Serum/Plasma Kit (Qiagen). Protein content was measured using the Micro BCA Protein Assay Kit (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was isolated by using miRNeasy Serum/Plasma Kit (Qiagen, Germantown, MD). The concentration of isolated RNA was measured by using Qubit™ microRNA Assay Kit in a Qubit 4 Fluorometer (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was extracted using the miRNeasy Serum/Plasma Advanced Kit (QIAGEN, Inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... and pEVs were isolated using miRNeasy serum/plasma kit (Qiagen, cat# 217184). Total RNA isolation was performed in an RNase-free environment ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins from HGCC cells and GBM tissue were extracted with the AllPrep DNA/RNA/Protein Mini Kit (Qiagen).
-
bioRxiv - Developmental Biology 2021Quote: ... 250 μl of Protein Precipitation Solution (QIAGEN) was added to each sample and were incubated on ice for 5 min followed by vigorous vortexing for at least 30 sec ...
-
bioRxiv - Molecular Biology 2021Quote: ... For protein purification Ni-NTA agarose (Qiagen) was used ...
-
bioRxiv - Genomics 2020Quote: ... 333 μL of Protein Precipitation Solution (Qiagen) was added to each sample which was then vortexed and then centrifuged at 2000 x g for 10 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein was purified by Ni-NTA (Qiagen) and eluted with 300 mM Imidazole ...
-
bioRxiv - Cell Biology 2021Quote: AllPrep DNA/RNA/Protein Mini Kits (Qiagen) were used to extract total proteins from UVA-exposed and non-exposed HTEpC from all experiments ...
-
bioRxiv - Systems Biology 2023Quote: ... and 20 µL Protein Kinase K (Qiagen) for 30 min at RT followed by the steps as described in the protocol of Dneasy Blood & Tissue Kit (QIAGEN) ...
-
Importin α/β Promote Kif18B Microtubule Association to Spatially Control Microtubule DestabilizationbioRxiv - Cell Biology 2022Quote: ... For protein purification using NiNTA agarose (Qiagen), cells were lysed in 50 mM phosphate buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were bound to Ni-NTA (Qiagen), washed with 10 column volumes of Buffer A ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were bound to Ni-NTA (Qiagen), washed with 10 column volumes of Buffer A ...
-
bioRxiv - Molecular Biology 2024Quote: ... The recombinant proteins were purified by Qiagen Ni-NTA resin ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteins were bound to Ni-NTA (Qiagen), washed with 10 column volumes of buffer A ...
-
bioRxiv - Biochemistry 2022Quote: Successful transfection and affitin expression were checked by Western blotting using a RGS-His6 HRP conjugate (Qiagen) to detect Affi_224 in a HEK-293T cell lysate ...
-
bioRxiv - Biochemistry 2024Quote: ... the membranes were treated with 1:3000 dilution of Qiagen anti-Penta His HRP conjugate (Qiagen 34460) and excess antibody removed with 3 washes in PBST for 20’.
-
bioRxiv - Immunology 2024Quote: SARS-CoV-2 specific T cell immune responses were evaluated by QuantiFERON SARS-CoV-2 (Qiagen) [36] ...