Labshake search
Citations for Qiagen :
101 - 150 of 1566 citations for Rat SEPT12 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... The plasmid was isolated using an endotoxin free plasmid isolation kit (EndoFree Plasmid Maxi Kit, Cat. No. 12362, QIAGEN). Before transfection THP1 cells were washed in serum free RPMI for 2 times ...
-
bioRxiv - Neuroscience 2020Quote: ... rat MPG were harvested and kept in RNAlater (Qiagen) immediately after cavernosometry ...
-
bioRxiv - Cell Biology 2019Quote: ... then mixed with BioMag goat-rat IgG beads (Qiagen) and Ter119+ cells were depleted using a Dynal magnet (Invitrogen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA plasmids were prepared using the Qiagen Plasmid Maxi Kit (Qiagen, Germany) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... Plasmid constructs were purified with the Endo-free Plasmid Maxiprep kit (Qiagen). The 140-nt repair template ssODN1 5’-GATTAAGACGATGTTGGAATATGCTGACAAGGTTTTCACTTACATTTTCATT CTGGAAATGCTTCTAACATGGGTGGCATATGGATATCAAACATATTTCACC AATGCCTGGTGTTGGCTGGACTTCTTAATTGTTGATG-3’ (Integrated DNA Technologies ...
-
bioRxiv - Genetics 2019Quote: ... and plasmid DNA was purified using the Plasmid Plus Mega Kit (Qiagen). The Anopheles gambiae PEST AgamP4 genome assembly available at Vectorbase was used as the reference genome (https://www.vectorbase.org/organisms/anopheles-gambiae/pest/agamp4).
-
bioRxiv - Cancer Biology 2020Quote: ... Plasmid DNA was purified from colonies using the Plasmid Purification Kit (Qiagen), and subsequently analyzed by Sanger sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... plasmid DNA was extracted with using Maxiprep Plasmid DNA extraction kit (Qiagen). A small aliquot was also inoculated on LB agar plate with 100 g/mL ampicillin to calculate the barcode diversity ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plasmid isolation and purification was done using plasmid miniprep kit (Qiagen, Germany) as per standard instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... The plasmid was extracted using a Plasmid Midi Kit (Cat# 12143, QIAGEN) according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2020Quote: ... Donor DNA plasmids were purified using EndoFree plasmid maxi kit (Qiagen, #12362) for engineering experiments.
-
bioRxiv - Bioengineering 2021Quote: ... and plasmid DNA was purified using a HiSpeed Plasmid Maxi Kit (Qiagen).
-
bioRxiv - Genetics 2022Quote: ... Plasmid DNA of positive clones was obtained using Plasmid Maxi Kit (Qiagen). The absence of mutations was verified by capillary sequencing.
-
bioRxiv - Plant Biology 2021Quote: ... or plasmids were extracted with a QIAprep Spin Plasmid Miniprep Kit (QIAGEN). PCR screen amplicons or plasmids were sequenced by Sanger sequencing using the PJET1-2F universal primer ...
-
bioRxiv - Plant Biology 2020Quote: ... The plasmids were extracted and purified using the Plasmid Midi Kit (QIAGEN) and then transformed into rice protoplasts according to the previously described procedure (Shen et al. ...
-
bioRxiv - Genomics 2021Quote: ... The plasmid library was extracted using a QIAGEN plasmid maxiprep column (Qiagen) and resuspended in 1 ml of TE.
-
bioRxiv - Genetics 2020Quote: ... Plasmids were prepared using silica-membrane based kit (Plasmid Miniprep Kit, Qiagen) following the manufacturer’s instructions and quantified using Nanodrop Spectrophotometer ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA plasmids were purified using Plasmid Mini/Midi or Maxi kits (Qiagen) according to manufacturer’s instructions ...
-
A genome-scale CRISPR interference guide library enables comprehensive phenotypic profiling in yeastbioRxiv - Genomics 2020Quote: ... Plasmid DNA was extracted with a QIAGEN Plasmid Midi Kit (QIAGEN 12143).
-
bioRxiv - Immunology 2020Quote: ... Donor DNA plasmids were purified using EndoFree plasmid maxi kit (Qiagen, #12362) for engineering test and zygote microinjection.
-
bioRxiv - Developmental Biology 2022Quote: ... Donor plasmid was purified using the Plasmid Plus Midi Kit (Qiagen #12943) prior to injection.
-
bioRxiv - Synthetic Biology 2022Quote: Plasmid DNA was purified from cells using a plasmid miniprep kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmids were recovered by several midi-preps (Qiagen Plasmid Plus Midi Kit).
-
bioRxiv - Microbiology 2023Quote: ... We sequenced plasmids and confirmed mutation after purification with plasmid purification (Qiagen). We expressed and purified Abs as described above ...
-
bioRxiv - Microbiology 2023Quote: ... We sequenced plasmids and confirmed mutations after purification with plasmid purification (Qiagen). For virus purification ...
-
bioRxiv - Biophysics 2023Quote: ... Plasmid DNA was isolated to high purity using EndoFree Plasmid kits (Qiagen). Purified plasmid DNA was mixed with PEI 25K (Polysciences ...
-
bioRxiv - Genetics 2023Quote: ... Plasmids were purified using a Qiagen Plasmid Midi Kit (Qiagen Cat. #12143), and DNA sequences were confirmed by Sanger sequencing.
-
bioRxiv - Genomics 2023Quote: ... All plasmids were purified using the Endotoxin-Free Plasmid Purification Kit (QIAGEN) prior to the in vivo gene-delivery experiment.
-
bioRxiv - Biochemistry 2023Quote: ... Plasmids were isolated using a QIAGEN Plasmid Midi Kit (Qiagen; catalog #12123) and concentrations were calculated using the known molecular weights based on each unique insert sequence ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids were isolated the next day using a Plasmid Miniprep Kit (Qiagen) and quantified using a Qubit fluorometer.
-
bioRxiv - Bioengineering 2023Quote: ... All plasmids were purified using Plasmid Plus Miniprep or Maxiprep kits (Qiagen).
-
bioRxiv - Molecular Biology 2023Quote: ... plasmid DNA preparation (QIAprep Spin MiniPrep Kit and Plasmid Midi Kit, Qiagen) and gel electrophoresis were performed according to the manufacturer’s instructions or using standard protocols (29) ...
-
bioRxiv - Genomics 2024Quote: ... Endotoxin-free plasmids were prepared using the EndoFree Plasmid Maxi Kit (QIAGEN) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids were prepared from VectorBuilder Escherichia coli stocks using Plasmid Miniprep (Qiagen) and ampicillin selection ...
-
bioRxiv - Cancer Biology 2024Quote: ... Plasmid DNAs were extracted with QIAGEN Plasmid Plus MIDI kit (QIAGEN 12941) for downstream applications.
-
bioRxiv - Synthetic Biology 2021Quote: ... plasmid purified (QIAgen, #27104), and transformed into E ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids were miniprepped (Qiagen) from carbenicillin resistant colonies and screened for the mucP insertion using oAC039/oAC040 ...
-
bioRxiv - Microbiology 2020Quote: ... plasmids were purified (Qiagen) at the Nevada Genomics Center ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the plasmid purified (Qiagen), and sequencing performed by Oxford Nanopore (PlasmidSaurus) ...
-
bioRxiv - Bioengineering 2023Quote: ... Plasmid extraction (Qiagen miniprep) was performed on the overnight cultures and plasmids were sequenced to determine successful mutagenesis.
-
bioRxiv - Immunology 2023Quote: ... followed by magnetic depletion using goat anti-rat beads (QIAGEN). For adoptive transfer experiments ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids were amplified using a HiSpeed Plasmid Purfication Midi kit (Qiagen, Hilden, Germany), and verified by cycle sequencing (Eurofins Genomics GmbH ...
-
bioRxiv - Developmental Biology 2021Quote: ... Bulk plasmid DNA was extracted using the Endofree Plasmid Maxi-prep kit (Qiagen) following manufacturer’s instructions and resuspended in 100µL of sterile water ...
-
bioRxiv - Neuroscience 2021Quote: ... The correct plasmids were then purified using the Plasmid Plus Purification Kit (Qiagen), injected into vasaφ31;attP2;attP40 ...
-
bioRxiv - Developmental Biology 2022Quote: ... gRNA library pool plasmid was harvested using EndoFree Plasmid Maxi Kit (12362, Qiagen). gRNA library quality was subsequently checked by next generation sequencing (NGS) ...
-
bioRxiv - Evolutionary Biology 2022Quote: Plasmid DNA was extracted from overnight cultures using a Plasmid Mini Kit (Qiagen), according to the manufacturer’s guidelines ...
-
bioRxiv - Genomics 2020Quote: ... The resulting plasmid pool was purified with the QIAfilter Plasmid Mega Kit (Qiagen). Representation and distribution of sgRNAs was analyzed by next generation sequencing.
-
bioRxiv - Genetics 2019Quote: ... Plasmid DNA was isolated using the Plasmid Plus Midi or Mini Kit (Qiagen).
-
bioRxiv - Cell Biology 2020Quote: ... All plasmids used for transfection were purified using the Plasmid Midi kit (Qiagen). Cells were harvested 36-48 h post-transfection for further analyses.
-
bioRxiv - Bioengineering 2020Quote: ... The plasmid library was then extracted using an EndoFree Plasmid Maxi kit (Qiagen). The lentivirus was then generated by co-transfecting the plasmid library ...