Labshake search
Citations for Qiagen :
101 - 150 of 1675 citations for Rat BRSK1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... The transfection of Wls-shRNA and pLCN-Wnt3a-HA and controls was performed by using HiPerFect transfection reagent (#301704, Qiagen) according to the manual ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA was extracted from AAV2-infected shRNA-scrambled and -TET2 dorsal hippocampi using an RNeasy Mini Plus Kit (Qiagen). 100 ng Total RNA was converted to cDNA using a iScript™ cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from live sorted fetal chondrocytes transduced with STAT3 shRNA or scrambled using the RNeasy Mini Kit (Qiagen). 500 ng of RNA was reverse transcribed using the Maxima First Strand cDNA Synthesis Kit (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and A498 cells infected with lentivirus expressing shRNA targeting the indicated transcripts was isolated using RNeasy Mini Kit (QIAGEN #74104) and QIAshredder (QIAGEN #79654) ...
-
bioRxiv - Immunology 2020Quote: ... The plasmid was isolated using an endotoxin free plasmid isolation kit (EndoFree Plasmid Maxi Kit, Cat. No. 12362, QIAGEN). Before transfection THP1 cells were washed in serum free RPMI for 2 times ...
-
bioRxiv - Neuroscience 2020Quote: ... rat MPG were harvested and kept in RNAlater (Qiagen) immediately after cavernosometry ...
-
bioRxiv - Cell Biology 2019Quote: ... then mixed with BioMag goat-rat IgG beads (Qiagen) and Ter119+ cells were depleted using a Dynal magnet (Invitrogen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA plasmids were prepared using the Qiagen Plasmid Maxi Kit (Qiagen, Germany) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... Plasmid constructs were purified with the Endo-free Plasmid Maxiprep kit (Qiagen). The 140-nt repair template ssODN1 5’-GATTAAGACGATGTTGGAATATGCTGACAAGGTTTTCACTTACATTTTCATT CTGGAAATGCTTCTAACATGGGTGGCATATGGATATCAAACATATTTCACC AATGCCTGGTGTTGGCTGGACTTCTTAATTGTTGATG-3’ (Integrated DNA Technologies ...
-
bioRxiv - Genetics 2019Quote: ... and plasmid DNA was purified using the Plasmid Plus Mega Kit (Qiagen). The Anopheles gambiae PEST AgamP4 genome assembly available at Vectorbase was used as the reference genome (https://www.vectorbase.org/organisms/anopheles-gambiae/pest/agamp4).
-
bioRxiv - Cancer Biology 2020Quote: ... Plasmid DNA was purified from colonies using the Plasmid Purification Kit (Qiagen), and subsequently analyzed by Sanger sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... plasmid DNA was extracted with using Maxiprep Plasmid DNA extraction kit (Qiagen). A small aliquot was also inoculated on LB agar plate with 100 g/mL ampicillin to calculate the barcode diversity ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plasmid isolation and purification was done using plasmid miniprep kit (Qiagen, Germany) as per standard instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... The plasmid was extracted using a Plasmid Midi Kit (Cat# 12143, QIAGEN) according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2020Quote: ... Donor DNA plasmids were purified using EndoFree plasmid maxi kit (Qiagen, #12362) for engineering experiments.
-
bioRxiv - Bioengineering 2021Quote: ... and plasmid DNA was purified using a HiSpeed Plasmid Maxi Kit (Qiagen).
-
bioRxiv - Genetics 2022Quote: ... Plasmid DNA of positive clones was obtained using Plasmid Maxi Kit (Qiagen). The absence of mutations was verified by capillary sequencing.
-
bioRxiv - Plant Biology 2021Quote: ... or plasmids were extracted with a QIAprep Spin Plasmid Miniprep Kit (QIAGEN). PCR screen amplicons or plasmids were sequenced by Sanger sequencing using the PJET1-2F universal primer ...
-
bioRxiv - Plant Biology 2020Quote: ... The plasmids were extracted and purified using the Plasmid Midi Kit (QIAGEN) and then transformed into rice protoplasts according to the previously described procedure (Shen et al. ...
-
bioRxiv - Genomics 2021Quote: ... The plasmid library was extracted using a QIAGEN plasmid maxiprep column (Qiagen) and resuspended in 1 ml of TE.
-
bioRxiv - Genetics 2020Quote: ... Plasmids were prepared using silica-membrane based kit (Plasmid Miniprep Kit, Qiagen) following the manufacturer’s instructions and quantified using Nanodrop Spectrophotometer ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA plasmids were purified using Plasmid Mini/Midi or Maxi kits (Qiagen) according to manufacturer’s instructions ...
-
A genome-scale CRISPR interference guide library enables comprehensive phenotypic profiling in yeastbioRxiv - Genomics 2020Quote: ... Plasmid DNA was extracted with a QIAGEN Plasmid Midi Kit (QIAGEN 12143).
-
bioRxiv - Immunology 2020Quote: ... Donor DNA plasmids were purified using EndoFree plasmid maxi kit (Qiagen, #12362) for engineering test and zygote microinjection.
-
bioRxiv - Developmental Biology 2022Quote: ... Donor plasmid was purified using the Plasmid Plus Midi Kit (Qiagen #12943) prior to injection.
-
bioRxiv - Synthetic Biology 2022Quote: Plasmid DNA was purified from cells using a plasmid miniprep kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids were prepared from VectorBuilder Escherichia coli stocks using Plasmid Miniprep (Qiagen) and ampicillin selection ...
-
bioRxiv - Cancer Biology 2024Quote: ... Plasmid DNAs were extracted with QIAGEN Plasmid Plus MIDI kit (QIAGEN 12941) for downstream applications.
-
bioRxiv - Genomics 2024Quote: ... Endotoxin-free plasmids were prepared using the EndoFree Plasmid Maxi Kit (QIAGEN) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmids were recovered by several midi-preps (Qiagen Plasmid Plus Midi Kit).
-
bioRxiv - Microbiology 2023Quote: ... We sequenced plasmids and confirmed mutation after purification with plasmid purification (Qiagen). We expressed and purified Abs as described above ...
-
bioRxiv - Microbiology 2023Quote: ... We sequenced plasmids and confirmed mutations after purification with plasmid purification (Qiagen). For virus purification ...
-
bioRxiv - Biophysics 2023Quote: ... Plasmid DNA was isolated to high purity using EndoFree Plasmid kits (Qiagen). Purified plasmid DNA was mixed with PEI 25K (Polysciences ...
-
bioRxiv - Genetics 2023Quote: ... Plasmids were purified using a Qiagen Plasmid Midi Kit (Qiagen Cat. #12143), and DNA sequences were confirmed by Sanger sequencing.
-
bioRxiv - Genomics 2023Quote: ... All plasmids were purified using the Endotoxin-Free Plasmid Purification Kit (QIAGEN) prior to the in vivo gene-delivery experiment.
-
bioRxiv - Biochemistry 2023Quote: ... Plasmids were isolated using a QIAGEN Plasmid Midi Kit (Qiagen; catalog #12123) and concentrations were calculated using the known molecular weights based on each unique insert sequence ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids were isolated the next day using a Plasmid Miniprep Kit (Qiagen) and quantified using a Qubit fluorometer.
-
bioRxiv - Bioengineering 2023Quote: ... All plasmids were purified using Plasmid Plus Miniprep or Maxiprep kits (Qiagen).
-
bioRxiv - Molecular Biology 2023Quote: ... plasmid DNA preparation (QIAprep Spin MiniPrep Kit and Plasmid Midi Kit, Qiagen) and gel electrophoresis were performed according to the manufacturer’s instructions or using standard protocols (29) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... the plasmid was purified using QIAGEN Endofree plasmid Maxi kit (QIAGEN; 12362). Purified plasmid was concentrated to 5mg/mL.
-
bioRxiv - Synthetic Biology 2021Quote: ... plasmid purified (QIAgen, #27104), and transformed into E ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids were miniprepped (Qiagen) from carbenicillin resistant colonies and screened for the mucP insertion using oAC039/oAC040 ...
-
bioRxiv - Microbiology 2020Quote: ... plasmids were purified (Qiagen) at the Nevada Genomics Center ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the plasmid purified (Qiagen), and sequencing performed by Oxford Nanopore (PlasmidSaurus) ...
-
bioRxiv - Bioengineering 2023Quote: ... Plasmid extraction (Qiagen miniprep) was performed on the overnight cultures and plasmids were sequenced to determine successful mutagenesis.
-
bioRxiv - Biochemistry 2024Quote: ... pQE-30 plasmids (Qiagen) containing the gene encoding HU-B F47W were transformed into XL1-Blue cells ...
-
bioRxiv - Immunology 2023Quote: ... followed by magnetic depletion using goat anti-rat beads (QIAGEN). For adoptive transfer experiments ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids were amplified using a HiSpeed Plasmid Purfication Midi kit (Qiagen, Hilden, Germany), and verified by cycle sequencing (Eurofins Genomics GmbH ...
-
bioRxiv - Developmental Biology 2021Quote: ... Bulk plasmid DNA was extracted using the Endofree Plasmid Maxi-prep kit (Qiagen) following manufacturer’s instructions and resuspended in 100µL of sterile water ...
-
bioRxiv - Neuroscience 2021Quote: ... The correct plasmids were then purified using the Plasmid Plus Purification Kit (Qiagen), injected into vasaφ31;attP2;attP40 ...