Labshake search
Citations for Qiagen :
101 - 150 of 216 citations for N Acetyl Tizanidine d4 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from P15 liver tissue (n=4 biological replicates per strain) using QIAzol Lysis Reagent (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: Bacterial genomic DNA was extracted from overnight (o/n) bacterial liquid cultures with DNeasy® Blood & Tissue Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... His-N-WASP ± MirA was loaded onto a column with 80 µL of previously equilibrated Ni-NTA resin (Qiagen) and incubated for 1 h at 4°C with agitation ...
-
bioRxiv - Genomics 2021Quote: ... total RNA was isolated from patient blood samples (CD19+ presorted n=161) using the RNA RNeasy mini kit (Qiagen). RNA quantification was performed with a Qubit 2.0 Fluorometer ...
-
bioRxiv - Cancer Biology 2022Quote: RNA from Nestin(N)/tv-a;Ink4a/Arf-/- neural progenitors was isolated using the RNeasy Kit (Qiagen, Catalog# 74104) and 1μg of total RNA was reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... viral RNA was extracted from AFs stocks using the QIAamp MinElute Virus Spin kit (cat. n° 57704, Qiagen, Germany), according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... was transformed with an N-terminally His-tagged fusion protein of cytHPPK/DHPS (At1g69190) in the vector pQE30 (Qiagen). Overnight cultures grown at 30°C in LB broth supplemented with 35 µg/mL kanamycin and 100 µg/mL ampicillin were sub-cultured to an OD600 of 0.6 - 0.7 and induced overnight at 16°C with 100 mM isopropyl β-D-1-thiogalactopyranoside ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... of vehicle and Acyl-GIP vehicle treated LDLR−/− mice (n = 5) using Qiazol according to the manufacturer’s instructions (Qiazol Lysis Reagent, QIAGEN). The quality of the RNA was determined with the Agilent 2100 BioAnalyzer (RNA 6000 Nano Kit ...
-
bioRxiv - Microbiology 2022Quote: ... N-terminal His-tagged SlPR1 and SlChi3 proteins were purified using Ni-nitrilotriacetic acid (Ni-NTA) affinity resin (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... DNA extraction of gill tissue (N = 16 individuals per population) was performed using the DNeasy Blood & Tissue Kit (Qiagen). Further purification of the extracted DNA was done with NucleoSpin® gDNA Clean-up (Macherey-Nagel) ...
-
bioRxiv - Microbiology 2019Quote: Initial N-gene amplicon analysis was performed with 0.2 μl Round 2 product using the QIAxcel (Qiagen, Hilden, Germany). For positive reactions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Those PDTOs that underwent FOLFOX treatment (n=14) had RNA extracted using the Qiagen RNAeasy micro kit (Qiagen, # 74004).
-
bioRxiv - Microbiology 2020Quote: Following 72 h post treatment with a sublethal concentration of compound 33 (3.13 µM), adult male worms (n = 20 worms, three biological replicates) were homogenized with a TissueLyser (Qiagen) and total histones extracted using the EpiQuikTM Total Histone Extraction kit (OP-0006 ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was isolated from dissected brains (n = 9 brains per experimental cohort) by RNeasy Mini Kit (Qiagen, 74104), with on-column removal of genomic DNA (Qiagen ...
-
bioRxiv - Immunology 2023Quote: RNAseq was performed on total PBMCs from n=36 individuals in our cohort using the AllPrep kit as per manufacturer’s instructions (Qiagen). RNA libraries ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Developmental Biology 2021Quote: RNA was extracted from appropriately staged embryos or whole larvae (n=10 /sample) using the RNeasy Plus Universal mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from heparinised blood of SI and SH mice (n=3 per housing group) using the RNeasy Protect Animal Blood Kit (Qiagen). Extracted RNA was hybridised at UCL genomics following standard Affymetrix protocols ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from blood (n=6 for each housing group) using the RNeasy Protect Animal Blood Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... 12 WT littermates) and two-month-old mice (adult, n = 4 per group) were lysed and homogenized in QIAzol Lysis Reagent (Qiagen). Total RNA purification was performed with the miRNeasy Micro Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2020Quote: Whole blood samples from 10 healthy volunteers (n = 5 females and n = 5 males) aged from 25 to 37 were collected into PAX gene RNA blood tubes (Qiagen). Total RNA samples were isolated using QIAcube automation with the PAXgene Blood miRNA Kit (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... PRRSV-2 RNA was used to amplify cDNA encoding the full-length of N gene by RT-PCR (One-step RT-PCR, QIAGEN) using specific primers with the forward containing a T7 promoter sequence at the 5’ end ...
-
bioRxiv - Microbiology 2019Quote: ... coli BL21 (DE3) as fusion proteins containing an N-terminal His6- tag and purified by immobilized metal-affinity chromatography (Ni-NTA, Qiagen). Full-length DosR was also expressed with N-terminal GST-tag ...
-
bioRxiv - Immunology 2021Quote: ... Copies of SARS-CoV-2 nucleocapsid (N) gene in homogenized tissues were determined using QuantiNova SYBR Green PCR kit (Qiagen) along with 2019-nCoV RUO Kit (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2020Quote: DNA extractions from the 8-week fecal samples (n = 8 per group) were performed using the Qiagen QIAmp DNA stool extraction kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... Genomic DNA from ∼250,000 neurons per sample (n = 3 samples per group) was extracted and purified (DNeasy Blood and Tissue DNA extraction kit, Qiagen) prior to RRBS (Ovation RRBS Methyl-Seq System ...
-
bioRxiv - Biophysics 2020Quote: ... All the constructs also contain a His6-tag at the N-terminus for affinity purification with Nickel-NTA agarose beads (Qiagen). Site-directed mutagenesis was performed using the QuickChange Lightning kit (Agilent Technology) ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA was isolated from 3D samples (n=2-3) by combining a TRIzol-based cell lysis with a RNeasy Mini Kit (Qiagen). Samples were collected at aforementioned timepoints ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant protein fragments were produced in Escherichia coli (strain M15) as fusion products with an N-terminal tag of six histidines using plasmid pQE30 (Qiagen) and purified from total bacterial lysates by nickel affinity chromatography ...
-
bioRxiv - Pathology 2022Quote: ... The N gene-specific primers were used to amplify 97 bp of SARS-CoV-2 N gene by conventional PCR and purified by Qiagen gel extraction kit (Qiagen ...
-
bioRxiv - Cancer Biology 2022Quote: Spheroid and monolayer samples (technical replicates n=3) of MUC-1 and NCI-H295R cells were processed for RNA extraction using the RNeasy Mini kit (Qiagen), followed by DNA removal (TURBO DNA-free™ Kit ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was isolated from single-cell clone or bulk GFP+ and GFP- cells (n = 3 with cells from three different mice in each group) using QIAzol lysis reagent (Qiagen). DNA was removed using the RNase-Free DNase Set (QIAGEN) ...
-
bioRxiv - Neuroscience 2019Quote: ... was extracted from P7 dissected neocortices separated from meninges of Ctrl and Nr2f1cKO mice (n=3) using the RNeasy Mini kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... total RNA was extracted from control and INPP5ED477N/D477N organoids (n=3 samples per genotype) using an RNeasy Plus Micro Kit (Qiagen) and reverse transcribed using Superscript™ IV VILO™ Master ezDNase enzyme (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Total RNA was extracted from individual filter sets (n = 2 per timepoint) using Qiagen RNeasy Mini Kit (Qiagen, Hilden, Germany) as in Harke et al ...
-
bioRxiv - Neuroscience 2021Quote: ... total RNA was isolated from laser-microdissected control and mutant samples (n = 4) using the RNeasy Micro Plus Kit (Qiagen). The isolated RNA was checked for purity and integrity using Nanodrop spectrophotometer and TapeStation (Agilent) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and for blood (n=3-4 for MEL077 and n=6-7 for MP46 per treatment group) using the QIAamp DNA Blood Mini kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... Cells were transiently transfected with cDNA encoding the mouse Piezo1 channel or its mutants tagged with GFP on its N-terminus in the pCDNA3 vector using the Effectene reagent (QIAGEN). Cells were then trypsinized and re-plated on poly-D-lysine-coated round coverslips 24 hours after transfection ...
-
bioRxiv - Microbiology 2022Quote: ... and digested DNA products were extracted from the agarose gel using the QIAquick Gel Extraction kit (QIAGEN, cat. n° 28704), according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: ... Cell debris were removed by centrifugation (35,000 g at 4°C for 20 min) and the N-terminal His-tagged proteins were purified from the supernatant using NiNTA agarose (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was extracted and purified from pooled scrambled control and genotyped cldn7b F0 knockout larvae (n=50 per group) at 7dpf using the RNeasy Plus Micro Kit (QIAGEN), followed by cDNA synthesis with the SuperScript IV VILO Master Mix Kit (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2019Quote: ... total RNAs were extracted from wild-type and Cables2-deficient EpiLCs at 2 days post-induction (n = 3) using RNeasy Plus Mini Kit (Qiagen). RNA quality was evaluated using Agilent Bioanalyzer with RNA 6000 Pico kit (Agilent Technologies Japan ...
-
bioRxiv - Genomics 2019Quote: Genomic DNA was extracted from fin clip samples (n=768 fish) using the commercial kit DNeasy Blood & Tissue Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... These plasmids were purified and DNA extracted using QIAGEN Plasmid Midi Kit (100) (cat. n° 12145, QIAGEN, Valencia, CA, USA), according to manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2020Quote: E9.5 hindbrain spanning rhombomeres 1-6 were dissected from wild type and mutant embryos (n=3) to obtain total mRNA preparations (miRNeasy Micro Kit, Qiagen). Sequencing libraries were prepared following the SMART-Seq v4 Ultra Low Input RNA (TaKaRa ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 21 days following X-ray exposure we extracted the total RNA (RNeasy® mini kit, Qiagen, cat. n. 74104) from 3 sponges for each treatment and control ...
-
bioRxiv - Microbiology 2021Quote: ... coli giant spheroplasts we used a N-terminally 6-His tagged version of TcMscS cloned into the expression plasmid pQE80 (Qiagen) with restriction sites BamHI and HindIII ...
-
bioRxiv - Microbiology 2020Quote: ... recombinant proteins were then separated from the His-tagged TEV protease (and the cut N-terminal portion) by gravity-flow separation on Ni-NTA agarose (Qiagen). Finally ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA was isolated from a pool of 20 mechanically homogenized embryos at 96 hpf for each sample (n=4) using TRItidy G (AppliChem) and 500 ng of cDNA was synthesized using QuantiTect Reverse Transcription Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... The supernatant of the transfected cells encoding for N-HIS-FAM19A5 was collected for Ni-NTA affinity chromatography (Qiagen, Germany). Purified N-HIS-FAM19A5 was then digested overnight at 30°C with AcTEV protease (Thermo Fisher Scientific ...