Labshake search
Citations for Qiagen :
101 - 150 of 10000+ citations for Mouse Thymosin Beta 4 TMSB4X ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Samples were enriched for CD45+ cells using an EasySep Mouse TIL (CD45) Positive Selection kit (STEMCELL) and RNA was extracted with an RNeasy Plus Mini Kit (Qiagen). TdLN samples were processed as previously described ...
-
bioRxiv - Immunology 2023Quote: ... Samples were again enriched for CD45+ cells using an EasySep Mouse CD45 Positive Selection kit (STEMCELL) and RNA was extracted with an RNeasy Plus Mini Kit (Qiagen). RNA was stored at −80°C until further processing.
-
bioRxiv - Molecular Biology 2020Quote: Purified RNA was isolated from mouse skin using the RNeasy Plus Mini Kit (Qiagen) after pulverization of the frozen skin tissue and homogenization with the QIAshredder system (Qiagen) ...
-
bioRxiv - Biochemistry 2019Quote: Fecal DNA from mouse colon was extracted by QIAamp PowerFecal DNA Kit (Qiagen, Germany) with minor modifications ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from mouse hippocampal samples using a RNeasy Mini kit (Qiagen), following the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... and from mouse tissue (liver, retina, RPE) using a DNeasy Blood & Tissue kit (Qiagen). Target sequences were PCR-amplified using 2X Taq PCR Smart mix (SolGent) ...
-
bioRxiv - Physiology 2020Quote: Whole RNA was extracted from mouse orbital fat samples using RNeasy mini-kits (Qiagen). cDNA was prepared using Superscript III first-strand synthesis kit (ThermoFisher) ...
-
bioRxiv - Pathology 2022Quote: Total RNAs were obtained from cells or mouse kidneys using RNeasy Mini Kit (Qiagen) and reverse transcribed using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... Viral RNA was subsequently isolated from mouse plasma using the MinElute Virus Kit (Qiagen) on the QiaCube ...
-
bioRxiv - Systems Biology 2022Quote: ... DNA was isolated from mouse tissues using the DNeasy Blood and Tissue Kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... Total RNA from mouse lungs was extracted using RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2019Quote: Total RNA (100–200 islets/mouse) was extracted using the RNeasy Mini Kit (Qiagen). RNA quality and quantity was measured on the Agilent 2200 TapeStation System ...
-
bioRxiv - Molecular Biology 2020Quote: Total mouse heart RNA was isolated with an RNeasy mini kit (Qiagen, Valencia, CA) or RNAqueous® Micro RNA isolation kit (Ambion ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA was extracted from mouse MLL-AF9 cells by RNeasy Micro Kit (Qiagen), 72 hours after transduction of the cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... for mouse samples and cell lines or with miRNeasy Mini Kit (Qiagen, Hilden, Germany) for human tissue samples ...
-
bioRxiv - Neuroscience 2023Quote: RNA from brain organoids and mouse tissue was extracted with RNeasy Mini Kit (Qiagen) for mRNA detection ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA was isolated from lentiviral injected mouse brains using the DNeasy kit from Qiagen according to the manufactures protocol with the help of a tissue grinder (Dixon Science) ...
-
bioRxiv - Neuroscience 2023Quote: RNA from whole mouse OE samples was extracted using RNeasy kit (Qiagen, Hilden, Germany), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: Genomic DNA from mouse blood was extracted using a DNeasy Blood & Tissue Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: RNA was extracted from cells and mouse tumors using the miRNeasy kit (Qiagen, #217004) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... L1-L5 mouse DRG was homogenized with an RNeasy Mini Kit (Qiagen, Valencia, CA) using on-column DNase-I digestion according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... spongiae DNA was extracted from mouse tissues using DNAeasy Blood and Tissue kit (Qiagen). The numbers of mice used in each individual experiment were calculated to permit detection of at least a two- to four-fold difference in bacterial loads between groups with 95% (two-sided ...
-
bioRxiv - Microbiology 2024Quote: Mouse cDNA was amplified with gene-specific primers and HotStarTaq Master Mix Kit (Qiagen) (Table 1) ...
-
bioRxiv - Molecular Biology 2024Quote: RNA was extracted from mouse islets using the RNAeasy Micro Kit (QIAGEN, Cat # 74004); RNA was extracted from flash-frozen liver and peripancreatic fat tissues using TRIzolTM (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was purified from mouse tissues using the RNeasy Plus Mini Kit (Qiagen) and then transcribed into cDNA using the iScript™ cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Genomics 2024Quote: ... Homogenization buffer for RNA purification was made by adding 1:100 beta-mercaptoethanol to Buffer RLT (Qiagen, Valencia, CA) and kept on ice until use ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from 4 mL of culture using the miRNAeasy Mini Kit (Qiagen, Hilden, Germany) and Qiazol lysis reagent ...
-
bioRxiv - Developmental Biology 2022Quote: The total RNA of 3-4 organoids was extracted using the RNeasy Plus Micro Kit (Qiagen), followed by reverse transcription to generate cDNA with GoScript Reverse Transcription Kit (Promega) ...
-
bioRxiv - Microbiology 2020Quote: ... 4°C) and total RNA was extracted from the supernatant using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: Total hippocampus RNA was isolated from 4-month olds rats using RNeasy Lipid Tissue Kit (Qiagen) as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated (n = 3 or 4 mice per sample) using the RNeasy Mini Kit (QIAGEN), and aRNA was synthesized with Ambion’s MessageAmp aRNA Kit (Catalog # 1750 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL of 10 mg/mL RNase A (DNeasy Blood &Tissue kit, #69504, Qiagen, Hilden, Germany) was added to each sample and incubated at 37°C for 2 h ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mg of roots of 4-day-old seedlings according to the RNeasy Plant Mini Kit (Qiagen). cDNA was synthesized from 1µg of total mRNA using the QuantiNova Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The 16S gene was amplified using primers 5’AGAGTTTGATCCTGGCTCAG and 5’GACGGGCGGTGWGTRCA ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from cultures using the DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The bacterial 16S rRNA variable region 4 (V4 ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was extracted from E17.5 hearts using the RNeasy Micro Kit (Qiagen; n = 4/genotype), followed by cDNA synthesis using the iScript cDNA Synthesis Kit (BioRad) ...
-
bioRxiv - Immunology 2023Quote: RPMs (4 × 105 cells) were harvested and total RNA was extracted with RNeasy micro kit (QIAGEN). RNA libraries were prepared using TruSeq stranded mRNA Library Prep Kit (Illumina) ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 OD600 of cells were harvested and RNA was extracted using the RNeasy Mini Kit (Qiagen) in conjunction with the RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Developmental Biology 2023Quote: ... total RNA was isolated from E17.5 hearts (n = 4/genotype) using a RNeasy Micro Kit (Qiagen). NanoString processing was completed by the Emory Integrated Genomics Core ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA was extracted from mouse testes using an RNeasy Kit (Qiagen, Germantown, MD, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: Genomic DNA was isolated from mouse tail tissue using DNeasy Blood and Tissue Kits (Qiagen) following digestion with proteinase K ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA was isolated from frozen mouse skin tissues using the RNeasy Plus kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was purified from laser-microdissected mouse SCN using the RNeasy Micro Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: Total RNAs were obtained from human UREC or mouse kidneys using RNeasy Mini Kit (Qiagen) and reverse transcribed using SuperScript II Reverse Transcriptase (Life Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA from mouse urothelium was obtained using the RNeasy mini kit (Qiagen, Courtaboeuf, France) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... genomic DNA was isolated from mouse tails using DNeasy Blood and Tissue Kit (Qiagen, #69506). PCR was carried out using Econo-Tag Plus Green 2x master mix and the following primers ...
-
bioRxiv - Neuroscience 2021Quote: RNA from bulk mouse brain tissue was extracted using the RNeasy Plus Mini Kit (Qiagen) and resuspended in nuclease-free water ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted from adult mouse hippocampal tissue using an RNeasy Plus Kit (Qiagen). Amplification of 5’ cDNA ends was performed using the GeneRacer™ Kit (Life Technologies ...
-
bioRxiv - Physiology 2022Quote: RNA was isolated from cells and mouse kidney using the RNeasy Mini Kit (Qiagen, DE). cDNA was generated using the QuantiTect reverse transcription kit with gDNA Wipeout (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: Mouse lungs were homogenized and RNA was extracted using the Qiagen RNeasy Mini Kit (Qiagen). Extracted RNA was used for cDNA synthesis using Superscript III reverse transcriptase (Invitrogen ...