Labshake search
Citations for Qiagen :
101 - 150 of 2361 citations for Methyl 2 trifluoromethylsulfonyloxy 1 naphthoate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... mixed with 1 mL phenol:chloroform:isoamyl alcohol (25:24:1 at pH 8) at 70°C for 12 min and bead beating for 2 min (Tissue Lyser II, Qiagen). The mixture was centrifuged at 4°C for 3 min at maximum speed and the aqueous phase was transferred to a new reaction tube ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Genetics 2023Quote: ... To prepare the protein column we loaded 2 mL (1 mL column volume) of Nickel NTA resin onto the 5 mL Polypropylene columns from Qiagen and the resin buffer was allowed to drain ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA (2 μg per sample) extracted from 1×106 BSCs was performed using the Qiagen RNA RNeasy Kit (Cat#74104, Qiagen) followed by library preparation with the Illumina TruSeq V2 Kit (Cat#20020594 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and HET(2)) and four biological replicates of PA-1 (WT and HET) cells was extracted using miRNeasy Mini Kit (Qiagen) followed by on-column DNAse digestion ...
-
bioRxiv - Microbiology 2024Quote: ... The footpad was ground in 1 mL of DMEM containing 2% FBS with steel beads using a Tissue-Lyser II (Qiagen) and debris was clarified by centrifugation at 8,000 x g for 10 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... Faeces was collected in pre-weighed tubes containing 1 ml PBS and homogenised with a steel ball for 2 minutes at 25 Hz using a Tissue-Lyser (Qiagen). Mice were euthanised at indicated time-points ...
-
bioRxiv - Plant Biology 2024Quote: ... Reverse transcription of 1–2 μg of RNA for cDNA synthesis was carried out using the Omniscript RT Kit (Qiagen).
-
bioRxiv - Genomics 2024Quote: ... Bxb1 integrase-edited Rep 1 and Rep 2 K562attB gDNA genomic DNA was extracted using DNeasy blood and tissue kit (Qiagen) and samples library preparation and Illumina short read sequencing with a target of 60x genomic coverage ...
-
bioRxiv - Genetics 2024Quote: ... 20 µM of Illumina primers and 1:2000 dilution of 2 ng/µl library on Rotor-Gene Q machines (Qiagen), program and primer sequences are in Table) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Real-time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18S rRNA gene was used as internal control for normalization ...
-
ST6GAL1-mediated heterogeneity in sialic acid levels potentiates invasion of breast cancer epitheliabioRxiv - Cancer Biology 2020Quote: ... Real time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18 S rRNA gene was used as internal control for normalization ...
-
bioRxiv - Microbiology 2021Quote: ... pCDNA-SARC-CoV-2 Wuhan-Hu-1 P681H S plasmid was then extracted using the QIAprep Spin Miniprep Kit (Qiagen N.V.) and Sanger sequencing was used to confirm incorporation of the mutation.
-
bioRxiv - Genomics 2022Quote: ... Trachea was dissected and immersed in 1 mL PBS in a 2 mL microcentrifuge tube (Fisherbrand, 14-666-315) containing one stainless steel bead (QIAGEN, 69989). After the homogenization ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA was extracted from cells (1-2 wells, 6 well plate) using an RNeasy Plus Mini Kit (Qiagen, Hilden, Germany), including a DNase step to remove residual DNA ...
-
bioRxiv - Synthetic Biology 2020Quote: ... For SARS-CoV-2 antigen detection the blots were incubated with 1:2000 Anti-His mouse monoclonal primary antibody (Qiagen, #34660) and then incubated with 1:10000 peroxidase labelled anti-mouse IgG secondary antibody (GE Healthcare) ...
-
bioRxiv - Neuroscience 2021Quote: ... Amplicons were separated on a 1-2% agarose gel and appropriate bands were excised and isolated using a gel extraction kit (Qiagen, USA). These fragments were inserted into the pcDNA3.1-based plasmid or cFUGW lentivirus vector using the T4 ligase (New England Biolabs ...
-
bioRxiv - Microbiology 2020Quote: ... or remaining mosquito bodies were collected separately in a 2ml Eppendorf Safe Lock tube with 250μl DMEM (2% FBS, 1% Sodium Pyruvate) with 25 mg/ml Amphotericin B and a stainless steel bead (Qiagen, Hilden, Germany). Samples were stored at −80°C.
-
bioRxiv - Evolutionary Biology 2022Quote: ... log-phase cells in the range of 1–2 × 108 cells using the Qiagen DNeasy® Blood and Tissue kit (Qiagen). We resuspended the genomic DNA in 10 mM Tris-HCl pH 8.5 and stored it at 4° until submission to the McDonnell Genome Institute at Washington University in St ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted from OSU-CLL cells (1.5e6 cells/mL) treated with DMSO or SpiD3 (1, 2 μM; 4 h) using the miRNeasy Mini Kit (Qiagen; Hilden, Germany) per manufacturer instructions and processed using the Universal Plus mRNA-Seq with NuQuant kit (Tecan ...
-
bioRxiv - Cancer Biology 2023Quote: DNA was extracted from NCI-PC35-1 and NCI-PC35-2 organoids using an AllPrep DNA/RNA Mini Kit (Qiagen 80204) according to the manufacturer’s protocol for animal cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... were homogenised in QIAzol reagent (1 mL) in a 2 mL safe lock tube with stainless steel beads using a TissueLyser II homogeniser (Qiagen, UK) at 30 Hz until fully homogenised (1-2 min) ...
-
bioRxiv - Cancer Biology 2024Quote: Genomic DNA was isolated from each KPC-1 and KPC-2 derived monoclonal line using a DNeasy Blood and Tissue kit (Qiagen 69504) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: SARS-CoV-2 specific T cell immune responses were evaluated by QuantiFERON SARS-CoV-2 (Qiagen) [36] ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL of Buffer EB (Qiagen), and 30 μL of Hybridization Enhancer ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mL Ni-NTA resin (Qiagen) was used for clarified cell lysate from 1 L bacterial culture ...
-
bioRxiv - Microbiology 2022Quote: ... 2) the DNeasy PowerWater Kit (Qiagen), which is optimized for the isolation of genomic DNA from filtered water samples ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNase I (2 mg (Qiagen) were dissolved in 30 mL of
-
bioRxiv - Microbiology 2024Quote: ... 2 µg of RNase A (Qiagen) were added to each sample ...
-
bioRxiv - Zoology 2024Quote: ... 2 µl 5x Q-Solution (QIAGEN), 1 µl primer mix (2 µM each primer) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl of inner PCR product was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 0.4 μl of 10 μM dNTP mix ...
-
bioRxiv - Microbiology 2022Quote: ... of the hamsters at 2 dpi or 2 days post-exposure (exposed naïve) using RNeasy kit (Qiagen) for viral load quantification and calculation of the Omicron:Delta ratio ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 mL samples were mixed into glass tubes containing 2 volumes of RNAprotect bacteria reagent solution (Qiagen). After mixing and incubating for 5 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: SARS-CoV-2 whole-genome sequencing was performed by using QIAseq DIRECT SARS-CoV-2 Kit (QIAGEN). The quality of paired-end reads obtained from MiSeq sequencing was analyzed by using Qiagen CLC Genomics Workbench 22.0.1 and the Identify ARTIC V3 SARS-CoV-2 Low Frequency and Shared Variants (Illumina ...
-
bioRxiv - Genetics 2020Quote: ... genomic DNA was extracted from 1-to 2-mm-long tail tips using the DNeasy® Blood & Tissue kit (Qiagen, Hilden, Germany). Genomic DNA (5 μl ...
-
bioRxiv - Cell Biology 2020Quote: ... The qPCR was performed using the TaqMan™ RNA-to-CT™ 1-Step kit (Thermo Fischer Scientific) and was run in a RotorGene-6000-2-plex (Qiagen). PCR conditions having reverse transcription at 48’C for 15 min ...
-
bioRxiv - Immunology 2022Quote: ... of soluble SARS-CoV-2 WA1 and SARS-CoV-2 Omicron BA.1 spike trimers were isolated from cell supernatants using a Ni-NTA column (Qiagen, Hilden, Germany). Eluents from Ni-NTA purifications were subjected to SEC using a HiLoad Superdex 200 16/600 column followed by a Superose 6 10/300 (Cytiva ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we homogenized 2-3 fecal pellets in 1 mL H2O using ceramic beads (NucleoSpin, Macherey–Nagel, Dueren, Germany) and a TissueLyser (Qiagen, Hilden, Germany), mixing the sample for 3 × 30 s at 4,500 rpm with a 10 s cooling break (< 0°C) ...
-
bioRxiv - Microbiology 2023Quote: ... we placed filters in 2 mL tubes with beads and 1 mL TE buffer (Qiagen plasmid isolation kit, Qiagen Germantown, MD, USA) and ran them in the tissue lyser at either ½ speed or max speed for 30 sec or 1 min ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from CaCo-2 cells infected with SARS-CoV-2 using the RNeasy Mini kit (Qiagen) including an in-column DnaseI treatment step ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...