Labshake search
Citations for Qiagen :
101 - 150 of 1477 citations for Human IgM Anti SARS CoV 2 Spike S1 Antibody CR3022 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Paleontology 2019Quote: Human 2 and 3: DNA was extracted from bones using QIAamp® DNA Investigator kit (56504, Qiagen). Bones were thoroughly washed (X5 ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339 ...
-
bioRxiv - Biophysics 2021Quote: ... and immunoblotting using anti-Strep antibodies (Qiagen).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... primary mouse anti-His antibody (QIAGEN, 34660), secondary goat anti-rabbit 800CW antibody (LI-COR ...
-
bioRxiv - Microbiology 2019Quote: Transformation with the plasmids identified in Table S1 was conducted by electroporating isolated plasmid DNA (Qiagen) into 50 μl competent cells at 1.8 kV ...
-
bioRxiv - Synthetic Biology 2021Quote: ... with primers pBEST_LinL_F and pBEST_LinL_R (Table S1) and subsequent purification using QIAquick PCR Purification Kit (Qiagen).
-
bioRxiv - Cancer Biology 2021Quote: ... 0.5 µL of a mixture of spike ins UniSp6 and cel-miR-39-3p (Qiagen) was added to the cDNA reaction ...
-
bioRxiv - Microbiology 2019Quote: HeLa cells (2×106) were transfected with 100 pmol of validated siRNAs against all human ZDHHCs [42] (Qiagen) using interferrin transfection reagent (Polyplus) ...
-
bioRxiv - Immunology 2020Quote: ... and detection was performed using anti-His antibody (Penta-His Antibody, #34660, Qiagen) followed by donkey-anti-mouse antibody labeled with AlexaFluor647 (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... or from fresh or silica gel dried leaves using the Plant DNeasy Extraction Kit (Qiagen; Table S1). Libraries from herbarium samples were prepared with 22–157 ng of gDNA using Illumina TruSeq Nano DNA LT Sample Prep kit (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... V3 and V6 (Table S1) were sequenced by extracting the DNA using DNeasy Blood & Tissue Kit (Qiagen) from overnight cultures ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757 ...
-
bioRxiv - Cell Biology 2019Quote: ... conjugated with anti-penta-his biotin antibody (Qiagen) for 1 and half hours at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary antibodies included: anti-Penta-His (QIAGEN, #34650), anti-FLAG M2 (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... and HRP–conjugated anti Penta-His antibody (Qiagen). Other chemicals used in this study were of an analytical grade or higher ...
-
bioRxiv - Cell Biology 2023Quote: ... were incubated with biotinylated anti-5His antibodies (Qiagen) and stored for up to 6 months with continuous rotation at 4°C in BRB80 (80 mM Pipes ...
-
bioRxiv - Epidemiology 2019Quote: Total RNA was extracted from SFTS virus IgM positive samples using a QIAamp viral RNA mini Kit (Qiagen, Germany), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... and detection was performed using anti-His primary antibody (Penta-His Antibody, #34660, Qiagen) followed by donkey-anti-mouse secondary antibody labeled with AlexaFluor647 (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: ... and detection was performed using anti-His primary antibody (Penta-His Antibody, #34660, Qiagen) followed by donkey-anti-mouse secondary antibody labeled with AlexaFluor647 (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: Total RNA of 1-2 x 106 human macrophages (2-4 biological replicates/ macrophage donors per condition, see Table S17) was isolated using RNeasy extraction kit (Qiagen) including DNAse treatment according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and gene expression was assessed using RT2 Profiler PCR Array Human WNT Signaling Pathway Plus (PAHS-043YC-2, Qiagen Germany). Arrays were run on QuantStudio6 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Immunology 2019Quote: ... Two times 2.5 × 105 of naive B cells (CD20+IgM+IgD+IgG−) were sorted and subjected to RNA isolation (RNeasy Micro Kit; Qiagen). Following the generation of cDNA using 5’RACE (rapid amplification of cDNA-ends ...
-
bioRxiv - Cell Biology 2019Quote: ... the mouse anti-penta-His antibody (Qiagen; Catalog #34660) was used at a 1:2,000 dilution in 3% BSA in PBS with sodium azide ...
-
bioRxiv - Biophysics 2019Quote: ... Biotinylated mouse anti-5xHis antibody was purchase from QIAGEN. Mouse anti Tubulin beta 3 antibody from BioRad (Hercules ...
-
bioRxiv - Biochemistry 2021Quote: ... and anti-His is a peroxidase-conjugated antibody (Qiagen). The membranes were incubated for 1 h at room temperature with horseradish peroxidase-conjugated goat anti-rabbit IgG (Sigma ...
-
bioRxiv - Synthetic Biology 2021Quote: ... or mouse anti-RGS-His antibody (Qiagen; cat # 34610) at 1:5000 dilution followed by goat anti-rabbit-HRP conjugate (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-penta-His antibody (34660; Lot# 136244018; Qiagen); mouse anti-Myc tag mAb ...
-
bioRxiv - Microbiology 2020Quote: ... The anti-His antibody conjugated to horseradish peroxidase (Qiagen) was used at a dilution of 1:5,000 ...
-
bioRxiv - Immunology 2022Quote: ... then incubated with the primary antibody anti-His (Qiagen) at a concentration of 1:2500 in a solution of 3% non-fat milk in TBS-T overnight at 4 °C ...
-
bioRxiv - Biophysics 2023Quote: ... Anti-Penta-His antibody was purchased from Qiagen (Germany).
-
bioRxiv - Biophysics 2023Quote: ... The antibodies were anti-RGSHis (Qiagen, Cat. No. 34650) and peroxidase-conjugated anti-mouse antibody (Dako ...
-
bioRxiv - Biochemistry 2022Quote: ... an anti GAPDH monoclonal antibody (SC-47724) or an anti RGS HIS6 HRP (QIAGEN). When necessary ...
-
bioRxiv - Evolutionary Biology 2022Quote: Genomic DNA from strains marked with KI in Table S1 was extracted using DNeasy Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s guidelines for Gram-negative bacteria ...
-
bioRxiv - Cancer Biology 2022Quote: ... Exosomal miRNAs were profiled using Human Serum/Plasma miRCURY LNA miRNA PCR array (Qiagen, #YAHS-106Y, Plate Format: 2 × 96-well).
-
bioRxiv - Immunology 2020Quote: ... A total of 78 serum samples (positive for HEV IgM in ELISA) were subjected to RNA extraction using QIAamp Viral RNA Mini Kit (Qiagen, Germany). Using SuperScript™ III One-Step RT-PCR System with Platinum™ Taq (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: The three cell mock communities (even, staggered, and spike-in) were diluted with Buffer AVE (Qiagen, Hilden, Germany) and split into eight replicates per mock and dilution for subsequent DNA extraction ...
-
bioRxiv - Biochemistry 2021Quote: ... Monoclonal mouse anti-StrepII and anti-His antibodies were obtained from QIAGEN (catalog number 34850) and Genscript (catalog number A00186) ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Evolutionary Biology 2021Quote: Genomic DNA was extracted for the ancestral strain (AN) and a single clonal isolate from each evolved population (S1-S10) using QIAamp DNA Blood Midi Kit (Qiagen) following the manufacturer’s recommendations from 50 mL culture incubated at 17 °C for 5 days in 75 cm2 flasks ...
-
bioRxiv - Molecular Biology 2020Quote: ... and oligos P5 and PE (see Table S1) size selected on a agarose gel and extracted using the MINelute extraction kit (QIAGEN).
-
bioRxiv - Biophysics 2019Quote: ... Total RNA was isolated from all generated cell lines (Table S1) at day 9 of differentiation using either the RNeasy Mini kit or the AllPrep DNA/RNA Mini kit (Qiagen). ATAC-seq in four cell lines (KO ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... two subadult flat males and six (four Gg and two gg genotypes) adult females (Table S1) using the RNeasy Plus Universal Mini kit (Qiagen). Before extraction ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... DNA from the 730 samples (370 A. millepora and 360 Pocillopora; Tab. S1) were extracted using the DNeasy 96 Tissue kit (Qiagen) following manufacturer instructions.
-
bioRxiv - Immunology 2021Quote: ... DNA was extracted from PBMCs obtained from diverse blood withdrawals (Supplementary Fig. S1) and MLung-derived TILs with DNeasy Blood & Tissue Kit (Qiagen). Whole exome sequencing and single nucleotide variant analyses from MInt were available from our previous publication and were afterwards obtained for MLung ...
-
bioRxiv - Molecular Biology 2022Quote: ... SiCBL4 and SiCBL7 promoters were respectively amplified using biotin-labeled primers (Table S1) synthesized by Sangon Biotech (Shanghai China) and purified using a PCR purification kit (Qiagen). EMSA was conducted using a LightShift Chemilumniescent EMSA Kit (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2023Quote: Total genomic DNA was extracted from tissue samples (Supplementary Table S1) preserved in 95% ethanol using the QIAampDNA extraction kit (Qiagen). Polymerase chain reaction (PCR ...
-
bioRxiv - Genomics 2023Quote: ... microbial DNAs from stool samples of three individuals (S1, S2, and S3) were extracted using the QIAamp DNA stool mini kit (Qiagen) and size-selected using a BluePippin instrument targeting the size range of 10-50 Kb according to the manufacturer’s protocol ...