Labshake search
Citations for Qiagen :
101 - 150 of 950 citations for Hexadecanoic acid 3 trimethylsilyl oxy methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: Twenty 3 mm disc punches (UniCore, Qiagen) from each leaf sample were placed in mini-tubes with a 3 mm ball bearing ...
-
bioRxiv - Neuroscience 2024Quote: ... using a 3 mm bead (Qiagen 69997) and agitation with the Tissue Lyser II (Qiagen ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted from 3 knockout and 3 littermate control samples using the QIAGEN RNeasy Micro Kit (QIAGEN 74004) according to the manufacturers protocol ...
-
bioRxiv - Microbiology 2020Quote: Nucleic acids were extracted using the AllPrep DNA/RNA Micro kit (Qiagen) for simultaneous purification of minute amounts of DNA and RNA from the same sample without making use of the carrier RNA ...
-
bioRxiv - Cell Biology 2020Quote: ... the resulting supernatant was incubated with nickel-nitrilotriacetic acid agarose beads (QIAGEN) pre-equilibrated with the washing buffer (20 mM HEPES ...
-
bioRxiv - Biochemistry 2021Quote: ... Cleared lysate was incubated with Ni-nitrilotriacetic acid (NTA) resin from Qiagen for 1hr at RT ...
-
bioRxiv - Zoology 2021Quote: Nucleic acids were extracted using a QIAamp MinElute Virus Spin Kit (QIAGEN) and used to construct the sequencing libraries ...
-
bioRxiv - Microbiology 2020Quote: ... then the nucleic acid was purified using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Viral ribonucleic acid (RNA) was extracted by viral RNA kit (Qiagen, Germany), reversed by reverse transcription kit (Promega ...
-
bioRxiv - Biochemistry 2022Quote: ... Ni(II)-nitrilotriacetic acid agarose (Ni-NTA) resin was purchased from Qiagen. L-Allylglycine was purchased from Cayman Chemical Company ...
-
bioRxiv - Molecular Biology 2022Quote: ... the His-SUMO conjugates were enriched using nickel-nitrilotriacetic acid beads (Qiagen). Upon multiple washing steps ...
-
bioRxiv - Molecular Biology 2022Quote: ... 100 µL of dry nickel-nitrilotriacetic acid-agarose (Ni-NTA) beads (QIAGEN), were equilibrated with Guanidinium buffer supplemented with 5 mM β-mercaptoethanol and 50 mM Imidazole pH 8.0 ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by purification using nickel-nitrilotriacetic acid (Ni-NTA) agarose resin (QIAGEN). The recombinant protein was desalted with PD-10 column (SephadexTM G-25M ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 1 μM Locked Nucleic Acid (LNA) oligo-d(T)30 (Qiagen) in primary-probe hybridization buffer composed of 40% formamide (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... Nucleic acids were extracted with the QIAamp Viral RNA mini kit (QIAGEN) to be further randomly amplified using a modified Whole Transcriptome Amplification 2 (WTA2 ...
-
bioRxiv - Microbiology 2021Quote: ... the supernatant was extracted with a nickel-nitrilotriacetic acid-agarose suspension (Qiagen) or a Pierce GST Spin Purification Kit (Thermo ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 μL of dry nickel-nitrilotriacetic acid-agarose (Ni-NTA) beads (QIAGEN), were equilibrated with Guanidinium buffer supplemented with 5 mM β-mercaptoethanol and 50 mM Imidazole pH 8.0 ...
-
bioRxiv - Bioengineering 2024Quote: ... the supernatant was incubated with Ni-nitrilotriacetic acid (NTA) agarose resin (Qiagen) for 1 hour at 4 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... for GST-tagged proteins or nickel– nitriloacetic acid (Ni-NTA) agarose (Qiagen) for His-tagged proteins (2 hr ...
-
bioRxiv - Biochemistry 2024Quote: ... Nickel-nitrilotriacetic acid (Ni-NTA) resin was obtained from Qiagen (Valencia, CA). Stain free gels (4-12% ...
-
bioRxiv - Biophysics 2023Quote: ... GlpG in supernatant was purified using nickel-nitrilotriacetic acid (Ni-NTA, Qiagen) affinity chromatography in 50 mM Tris-HCl buffer (pH 8.0 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was extracted using nucleic acid isolation kit (AllPrep® Qiagen) according to protocol instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant proteins were purified over nickel-nitrilotriacetic acid (Ni-NTA) Agarose (Qiagen). Therefore ...
-
bioRxiv - Biochemistry 2023Quote: ... the clarified supernatant was incubated with nickel-nitrilotriacetic acid agarose resin (QIAGEN) for 3 hours at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... Monovalent IgG was further purified by Ni- nitrilotriacetic acid (Ni-NTA) (Qiagen) column and then size exclusion column (superdex 200 ...
-
bioRxiv - Genomics 2024Quote: ... Nickel-nitrilotriacetic acid (Ni-NTA) resin was obtained from Qiagen (Valencia, CA), and stain-free gels (4-12% ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Immunology 2021Quote: ... from P0 Tbx1LacZ/+Crkl+/- (n=3) and their wildtype littermates (n=3) were sorted and fixed using RNAprotect Cell Reagent (Qiagen) for storage before sample submission to the Oxford Genomics Centre ...
-
bioRxiv - Molecular Biology 2021Quote: ... Oligonucleotides containing shRNA inserts were PCR-amplified with primers 5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’ and 5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ and purified with QIAquick PCR Purification Kit (Qiagen). shRNA inserts and miRE18_LT3GEPIR_Ren714 backbone (inducible via Tet-On system ...
-
bioRxiv - Microbiology 2021Quote: ... samples were thawed and homogenized with a single 3 mm Eliminase washed stainless steel ball bearing in for 3 min at 30 Hz (TissueLyser II, Qiagen) then purified by the Direct-zol RNA microprep kit (Zymo).
-
bioRxiv - Cell Biology 2021Quote: Total RNA from HGC (3 x 107 cells) and SPZEJ (3-30 x 107 cells) was extracted with the RNeasy Plus Mini Kit (Qiagen), and the purity and concentration of the extracted RNA was evaluated with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Cell Biology 2021Quote: To extract RNA from dissected aorta from amotl2ec+/ec+ (n=3) and amotl2ec-/ec- mice (n=3) was immersed in TRIzol and homogenised by TissueLyser (Qiagen) in TRIzol ...
-
bioRxiv - Neuroscience 2022Quote: sMN total RNA from DHMN1 patient (n = 3) and controls (n = 3) was isolated using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from cell pellets as previously described (61), and all six RNA samples (3 acetate, 3 DIET) were cleaned with the RNeasy Mini Kit (Qiagen) and treated with Turbo DNA-free DNase (Ambion) ...
-
bioRxiv - Plant Biology 2023Quote: ... samples were flash-frozen in liquid nitrogen immediately prior to grinding and ground using 3 mm glass beads at 30 Hz for 3 min in a TissueLyser II (Qiagen) to a fine powder ...
-
bioRxiv - Plant Biology 2023Quote: ... Arabidopsis thaliana frozen leaf tissues were weighed and ground by using two 3 mm stainless steel beads for 3 minutes at 30 Hz with frozen adapters on a TissueLyser II (Qiagen). The resulting frozen powder was dissolved in 650 µL chloroform-methanol (3:7 ...
-
bioRxiv - Immunology 2024Quote: Total RNA from epididymis white adipose tissue of wide type control mice (n=3) and miR-802 KI mice (n=3) was isolated using the RNeasy mini kit (Qiagen) following the protocol ...
-
bioRxiv - Microbiology 2024Quote: ... The DNA of the 20 Jan and 3 Mar 2021 samples (1/3 pellet) was extracted with the DNeasy UltraClean Microbial Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was obtained and amplified in a first-round PCR (RdRpS1 5’-GGKTGGGAYTAYCCKAARTG-3’, RdRpR1 5’-TGYTGTSWRCARAAYTCRTG-3’) using One-Step RT-PCR Enzyme MixKit (Qiagen) with the total expected size of 602 base pairs (bp) ...
-
bioRxiv - Genomics 2024Quote: ... RNA was first amplified using a first-round PCR (RdRp S1 5ߣ-GGKTGGGAYTAYCCKAARTG -3’, RdRp R1 5’-TGYTGTSWRCARAAYTCRTG-3’) with the One-Step RT-PCR Enzyme MixKit (Qiagen), targeting a total expected size of 620 base pairs (bp) ...
-
bioRxiv - Cell Biology 2024Quote: ... target sequence 5’-TTGCTTGGAGGCTACTCCCAA-3’) and control non-silencing scrambled siRNA (siSCR, target sequence 5’-AATTCTCCGAACGTGTCACGT-3’) were obtained from Qiagen. MAPK15-specific siRNA #2 (siMAPK15 #2 ...
-
bioRxiv - Genetics 2024Quote: ... Total RNA isolation from Tbx4-CKO (n = 3) and Tbx4fl/fl (n = 3) lungs was performed using the RNeasy Mini Kit (Qiagen). The changes in gene expression were investigated by quantitative reverse transcription polymerase chain reaction (RT-qPCR ...
-
bioRxiv - Biochemistry 2020Quote: ... 3-4 mL of Ni-NTA resins (Qiagen) were applied on the gravity column ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 3 ml RNAprotect Bacteria Reagent (Qiagen), divided into 3 × 1 ml aliquots (3 technical replicates) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3) QIAamp DNA Stool Mini Kit (QIAGEN®) and 4 ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’; Qiagen, Microsynth), si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’ ...
-
bioRxiv - Immunology 2021Quote: ... 3-4 pieces were placed into RNAlater (Qiagen) for gene expression analysis ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo #2 (Q2) 5’-CCCGAAATATTTAGGCCTGAA-3’ (Qiagen, SI00758415) and oligo 5 (Q4 ...
-
bioRxiv - Microbiology 2024Quote: ... The 3 PCR amplicons were gel purified (Qiagen), added in equimolar quantities ...