Labshake search
Citations for Qiagen :
101 - 150 of 1146 citations for Glycine N Fmoc 2 13C 99%;15N 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: Total RNA was extracted (n=3) from the frozen endosperm tissue using the RNeasy PowerPlant kit (Qiagen). An on-column DNase digest was incorporated during the extraction ...
-
bioRxiv - Microbiology 2023Quote: ... resuspended in 75 µL ddH2O and digested with DNaseI (QIAGen RNase-Free DNase set (ref. n°79524) for 10 min at RT ...
-
bioRxiv - Immunology 2023Quote: ... cells pooled from n = 3 - 5 mice / cohort) was isolated using the RNeasy Plus Mini Kit (Qiagen). Clariom S microarray analysis (Affymetrix ...
-
bioRxiv - Biochemistry 2023Quote: ... CBS proteins with a TEV cleavable N-terminal His-tag were purified using Ni-NTA agarose (Qiagen) resin and were treated to gel filtration using a Superose 6 Increase 16/600 column or Superdex 200 Hiload 16/600 column (Cytiva ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA from patient material (n=3) and organoids (xxx) was extracted (RNeasy™ Mini Kit, Qiagen). To obtain cDNA ...
-
bioRxiv - Neuroscience 2024Quote: ... Total RNA of equal pools of (n = 15) larval brains was extracted using the RNeasy kit (Qiagen). RNA was reverse transcribed to cDNA using the Super Script III First-strand synthesis system (Invitrogen) ...
-
bioRxiv - Molecular Biology 2019Quote: RNA was isolated from ~200 mg of VAT (N=30) using the RNeasy Lipid Tissue Mini Kit (Qiagen). RNA quality and quantity were analyzed using a NanoDrop spectrophotometer as described above ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was extracted from snap-frozen quadriceps muscles (n=4/genotype/sex) using RNeasy mini kit (Qiagen). The quality of total RNA was validated by Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Plant Biology 2020Quote: Bacterial genomic DNA was extracted from overnight (O/N) cultures using the Gentra Puregene Yeast/Bact Kit (Qiagen) (25/74 strains) ...
-
bioRxiv - Physiology 2021Quote: Total liver RNA was extracted from n=10 mice using a RNeasy Plus mini kit (Qiagen, Hilden, Germany). Total gonadal adipose RNA was extracted using a modified Tri-reagent (Sigma-Aldrich ...
-
bioRxiv - Genetics 2020Quote: ... 4 dpe on-tet n=3) was extracted using the Qiagen RNeasy Mini Plus Kit (Qiagen, Hilden, Germany), which includes a column-based genomic DNA removal step ...
-
bioRxiv - Microbiology 2021Quote: ... PBS/G was replaced with PBS/G containing 0.2 mg/mL proteinase K (Qiagen N. V., Hilden, Germany) or various concentrations of sodium azide ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were disrupted by sonication and N-terminus His6-tagged proteins were purified on Ni-NTA columns (Qiagen) according to manufacturer’s instruction ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA was extracted from pooled individuals (n = 10) using a DNeasy® Blood & Tissue kit (Qiagen, Hilden, Germany). A continuous long-read library was prepared and sequenced using PacBio Sequel II technology by Berry Genomics (Berry Genomics Co ...
-
bioRxiv - Genomics 2022Quote: ... DNA was extracted from pooled individuals (n = 70) using a DNeasy® Blood & Tissue kit (Qiagen, Hilden, Germany). A continuous long-read library was prepared and sequenced using PacBio Sequel II technology by Berry Genomics (Berry Genomics Co ...
-
bioRxiv - Microbiology 2023Quote: ... The N-terminal His-tagged Sif protein (Lmo0946-His6) was expressed and purified using Ni-NTA resin (Qiagen) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant both N-and C-terminally His-tagged proteins were purified using a Ni-NTA Superflow cartridge (1ml, Qiagen) and the Fast Protein Liquid Chromatography (FPLC ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from P15 liver tissue (n=4 biological replicates per strain) using QIAzol Lysis Reagent (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: Bacterial genomic DNA was extracted from overnight (o/n) bacterial liquid cultures with DNeasy® Blood & Tissue Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... His-N-WASP ± MirA was loaded onto a column with 80 µL of previously equilibrated Ni-NTA resin (Qiagen) and incubated for 1 h at 4°C with agitation ...
-
bioRxiv - Genomics 2021Quote: ... total RNA was isolated from patient blood samples (CD19+ presorted n=161) using the RNA RNeasy mini kit (Qiagen). RNA quantification was performed with a Qubit 2.0 Fluorometer ...
-
bioRxiv - Cancer Biology 2022Quote: RNA from Nestin(N)/tv-a;Ink4a/Arf-/- neural progenitors was isolated using the RNeasy Kit (Qiagen, Catalog# 74104) and 1μg of total RNA was reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... viral RNA was extracted from AFs stocks using the QIAamp MinElute Virus Spin kit (cat. n° 57704, Qiagen, Germany), according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... was transformed with an N-terminally His-tagged fusion protein of cytHPPK/DHPS (At1g69190) in the vector pQE30 (Qiagen). Overnight cultures grown at 30°C in LB broth supplemented with 35 µg/mL kanamycin and 100 µg/mL ampicillin were sub-cultured to an OD600 of 0.6 - 0.7 and induced overnight at 16°C with 100 mM isopropyl β-D-1-thiogalactopyranoside ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... of vehicle and Acyl-GIP vehicle treated LDLR−/− mice (n = 5) using Qiazol according to the manufacturer’s instructions (Qiazol Lysis Reagent, QIAGEN). The quality of the RNA was determined with the Agilent 2100 BioAnalyzer (RNA 6000 Nano Kit ...
-
bioRxiv - Microbiology 2022Quote: ... N-terminal His-tagged SlPR1 and SlChi3 proteins were purified using Ni-nitrilotriacetic acid (Ni-NTA) affinity resin (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... DNA extraction of gill tissue (N = 16 individuals per population) was performed using the DNeasy Blood & Tissue Kit (Qiagen). Further purification of the extracted DNA was done with NucleoSpin® gDNA Clean-up (Macherey-Nagel) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Those PDTOs that underwent FOLFOX treatment (n=14) had RNA extracted using the Qiagen RNAeasy micro kit (Qiagen, # 74004).
-
bioRxiv - Microbiology 2020Quote: Following 72 h post treatment with a sublethal concentration of compound 33 (3.13 µM), adult male worms (n = 20 worms, three biological replicates) were homogenized with a TissueLyser (Qiagen) and total histones extracted using the EpiQuikTM Total Histone Extraction kit (OP-0006 ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was isolated from dissected brains (n = 9 brains per experimental cohort) by RNeasy Mini Kit (Qiagen, 74104), with on-column removal of genomic DNA (Qiagen ...
-
bioRxiv - Immunology 2023Quote: RNAseq was performed on total PBMCs from n=36 individuals in our cohort using the AllPrep kit as per manufacturer’s instructions (Qiagen). RNA libraries ...
-
bioRxiv - Immunology 2023Quote: SARS-CoV-2 specific T cell immune responses were evaluated by QuantiFERON SARS-CoV-2 (Qiagen) [36] ...
-
bioRxiv - Microbiology 2019Quote: ... containing 2 ml microcentrifuge tubes (QIAGEN) in which samples were placed ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL of Buffer EB (Qiagen), and 30 μL of Hybridization Enhancer ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µg/mL RNase A (QIAgen), 1/200 (v/v ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mL Ni-NTA resin (Qiagen) was used for clarified cell lysate from 1 L bacterial culture ...
-
bioRxiv - Microbiology 2022Quote: ... 2) the DNeasy PowerWater Kit (Qiagen), which is optimized for the isolation of genomic DNA from filtered water samples ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNase I (2 mg (Qiagen) were dissolved in 30 mL of
-
bioRxiv - Microbiology 2024Quote: ... 2 volumes of RNA protect* (Qiagen) was added to cultures prior centrifugation (10 min 12,000 g ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Developmental Biology 2021Quote: RNA was extracted from appropriately staged embryos or whole larvae (n=10 /sample) using the RNeasy Plus Universal mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from heparinised blood of SI and SH mice (n=3 per housing group) using the RNeasy Protect Animal Blood Kit (Qiagen). Extracted RNA was hybridised at UCL genomics following standard Affymetrix protocols ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from blood (n=6 for each housing group) using the RNeasy Protect Animal Blood Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... 12 WT littermates) and two-month-old mice (adult, n = 4 per group) were lysed and homogenized in QIAzol Lysis Reagent (Qiagen). Total RNA purification was performed with the miRNeasy Micro Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2020Quote: Whole blood samples from 10 healthy volunteers (n = 5 females and n = 5 males) aged from 25 to 37 were collected into PAX gene RNA blood tubes (Qiagen). Total RNA samples were isolated using QIAcube automation with the PAXgene Blood miRNA Kit (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... PRRSV-2 RNA was used to amplify cDNA encoding the full-length of N gene by RT-PCR (One-step RT-PCR, QIAGEN) using specific primers with the forward containing a T7 promoter sequence at the 5’ end ...
-
bioRxiv - Microbiology 2019Quote: ... coli BL21 (DE3) as fusion proteins containing an N-terminal His6- tag and purified by immobilized metal-affinity chromatography (Ni-NTA, Qiagen). Full-length DosR was also expressed with N-terminal GST-tag ...
-
bioRxiv - Microbiology 2020Quote: DNA extractions from the 8-week fecal samples (n = 8 per group) were performed using the Qiagen QIAmp DNA stool extraction kit (Qiagen) following the manufacturer’s protocol ...