Labshake search
Citations for Qiagen :
101 - 150 of 3720 citations for E 6 2 6 6 Trimethylcyclohex 2 en 1 yl hex 5 ene 2 4 dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Tissues were homogenized at 300 Hz for 6 minutes using the TissueLyser II (QIAGEN). Homogenized samples were serially diluted at 1:10 in PBS ...
-
bioRxiv - Neuroscience 2024Quote: Total RNA was purified from 6-week-old GABAergic neurons using Rneasy kit (Qiagen). Dnase I on-column digestion was performed to avoid genomic DNA contamination.
-
bioRxiv - Systems Biology 2023Quote: ... A culture volume equal to 3 mL of OD = 1 was added to 6 mL RNAprotect Bacteria Reagent (Qiagen), vortexed ...
-
bioRxiv - Cell Biology 2022Quote: ... with 1% 2-mercaptoethanol then passed through Qiashredder tubes (Qiagen). RNA was extracted using the RNeasy Isolation Kit (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... loaded with 1-2 ml Ni-NTA agarose resin (Qiagen) pre-equilibrated with binding buffer ...
-
bioRxiv - Microbiology 2020Quote: ... 2 mL of fermentor culture was added to 4 mL RNAprotect Bacteria Reagent (Qiagen) and immediately vortexed for 10 sec ...
-
bioRxiv - Pathology 2023Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Pathology 2022Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Microbiology 2021Quote: The cells were lysed by high speed vortexing for 2 minutes using lysing matrix E tubes (MP Biomedical) in buffer RLT (Qiagen) amended with 1% 2-mercaptoethanol ...
-
bioRxiv - Microbiology 2023Quote: ... preceded by a 10-minute bead-beating step at 30 Hz in 2 ml e-matrix tubes (MP Biomedical, USA) using a Tissuelyser II (Qiagen). Molarity and fragment-length distribution of the extracts were measured using a Tapestation ...
-
bioRxiv - Cell Biology 2020Quote: ... Kinetochore proteins were conjugated to these beads using antibodies that recognize specific proteins or their tags: biotinylated anti-His-tag antibodies (6 µg ml−1, Qiagen), biotinylated anti-GFP antibodies (20 µg ml−1 ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... we transfected S2 cells in each well of a 6-well plate with 1 µg each of HA/GFP-tagged constructs using Effectene (Qiagen). After incubation for 3 days ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were washed twice with 1× PBS and total DNA was extracted at 6 hpi with DNeasy Blood/Tissue DNA mini kit (Qiagen) and quantitated by a nanodrop spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... pHIVec2.luc reporter plasmid and psPAX2 packaging plasmid (catalog number 11348, NIH AIDS Reagent Program) in a ratio of 1:6:3 using either Effectene (Qiagen) or calcium phosphate ...
-
bioRxiv - Immunology 2023Quote: ... Cells were stimulated with LPS (1 μg/ml) for 6 hours at 37°C followed by RNA isolation using a RNeasy Kit (QIAGEN). Extracted RNA was converted to cDNA with an iScript cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Genomics 2024Quote: Genomic DNA was extracted from 30-70 mg of tissue or 5.0 x 10^6 cells for Source 1 cell lines using commercially available QIAGEN QIAamp Mini Kit (QIAGEN, 51304), following the manufacturer’s protocol ...
-
bioRxiv - Pathology 2024Quote: ... liver was homogenized in 500uL of 3:1:6 isopropanol:water:ethyl acetate containing internal standard in ceramic bead tubes (Qiagen #13113-50) using the TissueLyzer II (Qiagen #9244420) ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were washed twice with 1× PBS and total DNA was extracted at 6 hpi with a DNeasy Blood/Tissue DNA mini kit (Qiagen) and total DNA yield was measured by a nanodrop spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2024Quote: ... RNA was isolated from cultures incubated or not with 1 µM staurosporine for 6 hours to induce apoptosis using the RNeasy Mini Kit (QIAGEN). RNA samples were checked for quality on Agilent 4200 TapeStation System (Agilent Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... vIL-6 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using QuantiTect Multiplex RT-PCR Kits (Qiagen) as described previously (37 ...
-
bioRxiv - Neuroscience 2020Quote: ... Amplified fragments were sequenced (Secugen S.L., Madrid) and analysed using CLC Sequence Viewer 6 (Qiagen).
-
bioRxiv - Molecular Biology 2022Quote: ... for 6 h at 55 °C followed by purification with a Qiaquick PCR Kit (Qiagen). Libraries were prepared using a MicroPlex Library Preparation Kit (Diagenode ...
-
bioRxiv - Genetics 2022Quote: ... Cells were transfected in 6-well plates at 80% confluency using Effectene transfection reagent (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... and 6 days after being transferred into SIM medium using miRNeasy Mini Kit (QIAGEN, 217004). High-quality RNA was used to prepare sequencing libraries with the MGIEasy RNA library preparation kit ...
-
bioRxiv - Immunology 2020Quote: ... Gene specific primers for IL-6 (Hs_IL6_1_SG QuantiTect Primer Assay) was sourced from QuantiTect (Qiagen) primers ...
-
bioRxiv - Molecular Biology 2023Quote: S2 cell transfections were carried out in 6-well plates using Effectene transfection reagent (Qiagen). Each well was transfected with 1 μg of the pAc5.1-λN-HA:dFMRP and 1 μg pAFW-AGO1 or pAFW-GW182 plasmids ...
-
bioRxiv - Molecular Biology 2023Quote: S2 cell transfections were carried out in 6-well plates using Effectene transfection reagent (Qiagen). Each well was transfected with 1 μg of the pAc5.1-EGFP:dFMRP and 1 μg of pAc5.1-mCherry plasmids containing DCR1 ...
-
bioRxiv - Immunology 2023Quote: ... muris isolates (6 in total) were extracted via a DNeasy Blood and Tissue kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... corpus (segment 6-7) and cauda (segment 8-10) samples using QIAzol Lysis Reagent (Qiagen) following the manufactureŕs recommendation using a bead-based tissue homogenizer (Retsch ...
-
bioRxiv - Microbiology 2024Quote: ... 1.5x105 Acanthamoeba castellanii cells were transfected with 6 μg of linearized plasmid using Polyfect (QIAGEN) in phosphate saline buffer (PBS) ...
-
bioRxiv - Cell Biology 2023Quote: ... High speed supernatant was combined with 6 mL of Ni-NTA Agarose (Qiagen, Cat# 30230) and stirred in a beaker for 1-2 hour(s ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was extracted from cells in 6 cm dishes using the RNeasy kit (Qiagen # 74106) according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with guide RNAs for Rme-6 knockdown using Polyfect Transfection reagent (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified extract was supplemented with 10 mM imidazole and rotated for 2 hours at 4 °C with 1 ml of Ni-NTA beads (Qiagen). Bound protein was eluted with 10 CV of buffer L / 200 mM imidazole ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Immunology 2024Quote: SARS-CoV-2 specific T cell immune responses were evaluated by QuantiFERON SARS-CoV-2 (Qiagen) [36] ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μl of bisDNA was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 2 μl of 10 μM primer mix (Methods Table 1) ...
-
bioRxiv - Biophysics 2022Quote: ... the supernatant was incubated for 2 h at 4 °C with Ni2+-NTA-agarose (Qiagen) (20 mg of proteins/ml of resin ...
-
bioRxiv - Immunology 2021Quote: ... Skin samples were homogenized in a TissueLyser LT (Qiagen, 50 Hz, 2 times 4 minutes) using 5 mm stainless steel beads (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: Total mRNA from 2 to 4 organoids were isolated using the RNeasy mini kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... 15 mM DTT) and then treated with 2 μL of 4 mg/mL Protease (QIAGEN) by incubation at 55°C for 6 hours ...
-
bioRxiv - Microbiology 2021Quote: ... In replicates 1 and 2 a Universal extraction robot (Qiagen, Germany) and associated nucleic acid extraction (Qiagen ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL of Buffer EB (Qiagen), and 30 μL of Hybridization Enhancer ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mL Ni-NTA resin (Qiagen) was used for clarified cell lysate from 1 L bacterial culture ...
-
bioRxiv - Microbiology 2022Quote: ... 2) the DNeasy PowerWater Kit (Qiagen), which is optimized for the isolation of genomic DNA from filtered water samples ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNase I (2 mg (Qiagen) were dissolved in 30 mL of
-
bioRxiv - Microbiology 2024Quote: ... 2 µg of RNase A (Qiagen) were added to each sample ...
-
bioRxiv - Zoology 2024Quote: ... 2 µl 5x Q-Solution (QIAGEN), 1 µl primer mix (2 µM each primer) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... ~5×108 cells (1 ml of OD600 0.5) were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and pelleted ...
-
bioRxiv - Genetics 2023Quote: ... To prepare the protein column we loaded 2 mL (1 mL column volume) of Nickel NTA resin onto the 5 mL Polypropylene columns from Qiagen and the resin buffer was allowed to drain ...