Labshake search
Citations for Qiagen :
101 - 150 of 10000+ citations for Atrial Natriuretic Peptide ANP ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... and an undisclosed peptide pool inducing CD8+ T lymphocyte stimulation (Qiagen, 2017); rmsHBHA which tubes contain recombinant M ...
-
bioRxiv - Microbiology 2021Quote: Confluent 6-well plates of BAC16-iSLK.RTA cells were lysed using a DNeasy Blood and Tissue Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was isolated from Cac-P4.5 cells (originating from the PtP4.5 selection plate) using the MagAttract HMW DNA Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Worms were washed from each plates and genomic DNA was extracted using Qiagen DNeasy Blood & Tissue Kit (Qiagen) and quantified by Qubit (Invitrogen) ...
-
bioRxiv - Genetics 2022Quote: ... RNA was extracted from cells grown in 6-well plates using RNeasy Mini Kit (Qiagen, Germantown, MD, USA) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: CYP124 was crystallized using a sitting drop approach in 96-well crystallization plates with commercially available kits (Qiagen) at 20 °C with 1:1 protein/mother liquor ratio with the ligand concentration of 100 μM ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Cells were collected again using filter plates and subjected to DNeasy 96 Blood and Tissue Kit (Qiagen 69581) (yielding 4-15μg per strain).
-
bioRxiv - Neuroscience 2023Quote: RNA was extracted from individual wells of 24-well culture plates using a RNeasy Plus Mini Kit (Qiagen) per the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: Genomic DNA was isolated from Streptomyces plates or liquid cultures using the DNeasy PowerLyzer PowerSoil Kit (Qiagen, Germany). The bead beating was performed using a TissueLyser LT (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: RNA from human cell cultures was extracted from 6 well plates using RNeasy Plus micro kit (Qiagen, 74034). The plates were washed once with PBS ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was isolated from 5-week-old Arabidopsis leaves with RNeasy Plant Mini Kit (74904; Qiagen) and used for subsequent RT-qPCR analysis ...
-
bioRxiv - Microbiology 2021Quote: Reverse transcription was performed on 5 μl of RNA suspension using QuantiTect Reverse Transcription kit (Qiagen) with either the qiagen RT primer mix or the SgleadSARSCoV2-F primer (for negative strand viral transcripts ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was isolated from adult (5-week-old) plants using an RNeasy plant kit (Qiagen), treated with a TURBO DNA-free kit (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was prepared from 5×106-1×107 cells using the RNeasy MIDI Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... AAVS1 +161 bp Reverse 5’ GAGGTTCTGGCAAGGAGAGA) and purified using the PCR clean up kit (Qiagen, MD). Amplicons were sequenced by MiSeq (Illumina ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 5×106 human PBMCs from Cohort II using AllPrep RNEasy kits (Qiagen) and the small RNA-containing column flow-through collected ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 male C57Bl/6 mice-derived pial tissue was extracted using RNeasy Micro Kit (Qiagen, #74034). After RiboGreen quantification and quality control by Agilent BioAnalyzer ...
-
bioRxiv - Biochemistry 2020Quote: ... and pJET_Luc_FL_UTR_REV (5’-GCAATGAAAATAAATGTTTTTTATTAGGCAGAATCCAAATGC-3’) primers and was purified with the QIAquick PCR Purification Kit (Qiagen) directly after the PCR reaction ...
-
bioRxiv - Genomics 2020Quote: ... before aliquoting into 5 tubes and proceeding with the Qiagen DNeasy Plant Mini Kit (Qiagen; 69104) protocol ...
-
bioRxiv - Biophysics 2022Quote: ... to dephosphorylate 5’ ends.Digested inserts were gel extracted using the QiaQuick gel extraction kit (Qiagen, Germany). Digested and 5’ dephosphorylated vector was purified using the QiaQuick PCR Cleanup kit (Qiagen ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA from 5 embryos was extracted using the RNeasy microRNA isolation kit (Qiagen, Valencia, CA), and the RNA samples were digested on-column with RNase-free DNase I to eliminate genomic DNA ...
-
bioRxiv - Genomics 2022Quote: We extracted RNA from 5 × 105 cells using the QIAGEN RNeasy Mini kit (Qiagen, cat # 74014) with DNase I treatment (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was prepared from approximately 5×106 cells using the DNeasy-96 kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of each reaction mixture was used for amplification with the REPLI-g kit (Qiagen) at 16 °C overnight and cleaned with the DNA Clean & Concentrator kit to yield samples for sequencing ...
-
bioRxiv - Microbiology 2024Quote: ... left still for 5 min and transferred to a RNeasy spin column (RNeasy Mini kit, QIAGEN). The column was washed two times with RPE buffer before elution in RNA-free water ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The obtained 5□- and 3□-RACE products were purified using a QIAquick Gel Extraction Kit (QIAGEN), subcloned into a pTAC-2 Vector (Bio Dynamics Laboratory lnc. ...
-
Immune profiling in M. tuberculosis infection enables stratification of patients with active diseasebioRxiv - Immunology 2019Quote: Supernatants from QFT and TruC tubes were analyzed for IFNγ by standard ELISA (Qiagen) and values were expressed in IU/mL ...
-
bioRxiv - Immunology 2020Quote: Ni-NTA plates (Qiagen) were loaded with 2 μg/mL of SARS-CoV-2 S protein in TBS for 2 h at RT ...
-
bioRxiv - Cancer Biology 2023Quote: ... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 12-273 BM cells at 80% confluence in 6 well plates using the RNeasy Mini Kit (Qiagen 74104). 600 ng of RNA was subjected to DNase I treatment and reverse transcription ...
-
bioRxiv - Genomics 2021Quote: ... in a 15 ul reaction volume in 96-well plates or with the Repli-g Single Cell kit (Qiagen) in a 10 ul reaction volume in 384-well plates ...
-
bioRxiv - Biochemistry 2020Quote: CYP124–SQ109 was crystallized by a sitting drop approach in 96-well crystallization plates with commercially available kits (Qiagen) at 20 °C with 1:1 protein/mother liquor ratio with the ligand concentration of 100 μM ...
-
bioRxiv - Cell Biology 2022Quote: Cells were seeded at 800,000 in 60 mm plates and 24 h later RNA was isolated (Qiagen RNeasy Kit). 1 ug of RNA was reverse transcribed (Applied Biosystem) ...
-
bioRxiv - Cell Biology 2022Quote: Cells were seeded at 800,000 in 60 mm plates and 24 h later RNA was isolated (Qiagen RNeasy Kit). 1 μg of RNA was reverse transcribed (Applied Biosystems™ High-Capacity cDNA Reverse Transcription Kit) ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA was isolated from cells in 96-well plates using the Qiagen FastLane Cell Probe Kit (QIAGEN, 216413), according to the manufacturer’s instructions to a final volume of 40 μL per well ...
-
bioRxiv - Cancer Biology 2019Quote: FTE cells were harvested from 6 cm plates and RNA was isolated using miRNAeasy micro kit (Qiagen, Hilden, Germany). Quantity and quality of total RNA was analyzed using Nanodrop (Thermo Scientific) ...
-
bioRxiv - Genomics 2019Quote: ... while the manual plate samples were processed using the Qiagen DNeasy PowerSoil HTP 96 kit (Qiagen, Cat# 12955-4).
-
bioRxiv - Genetics 2020Quote: ... Sample libraries were purified using a plate from a MinElute 96 UF PCR Purification Kit (QIAGEN Inc., Hilden, Germany), vacuum manifold ...
-
bioRxiv - Physiology 2023Quote: ... RNA was pooled from 3-4 wells of an MEA plate and then extracted using the miRNeasy kit (Qiagen). RNA levels were measured using the nanoString nCounter® PlexSet™ (nanoString ...
-
bioRxiv - Cell Biology 2022Quote: Cells were grown in 6 well plates and total mRNA was isolated using the RNeasy Kit (Qiagen, 74-104) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: RNA was extracted from ∼70% confluent HeLa cells grown in 6-wells plate using the RNeasy Micro Kit (Qiagen) with a DNase step according to the manufacturer’s instruction ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... genomic DNA was extracted from individual flies in 96 well plates using the Puregene Tissue Kit (Qiagen, Venlo, Netherlands). Each Illumina library was comprised 384 individual barcoded genomes ...
-
bioRxiv - Developmental Biology 2021Quote: ... Genomic DNA (gDNA) was extracted from 1-5×106 cells using DNeasy Blood and Tissue Kit (Qiagen) and 250 ng gDNA ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmids were isolated from 5 mL of overnight liquid culture using QIAprep Spin Miniprep Kit (Qiagen, Germany) and the presence of mutations was confirmed by Sanger Sequencing.
-
bioRxiv - Synthetic Biology 2021Quote: mESC gDNA was purified from 1-5 million cells using the QIAamp DNA mini kit (Qiagen 51306) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA from 5×105 FACS sorted p7 MPs was isolated using the RNeasy Micro Kit (Qiagen). RNA quantity and quality was tested on a Qubit®Fluorometer (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 ng of each RNA was reverse transcribed to cDNA using the miRCURY reverse transcription kit (Qiagen). Qiagen’s miRCURY Locked Nucleic Acid (LNA ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA was extracted from approximately 5×105 CD133 purified progenitors using an RNeasy micro kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: ... RNA was isolated from 5-6 replicated lung slices from each treatment using miRNeasy Mini Kit (Qiagen) at time 0 and time 120 hours for all groups ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA was extracted from pools of 3-5 second leaves using the Plant RNAeasy kit (Qiagen) using manufacturer’s instructions ...