Labshake search
Citations for Qiagen :
101 - 150 of 10000+ citations for Aldosterone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... AAVS1 +161 bp Reverse 5’ GAGGTTCTGGCAAGGAGAGA) and purified using the PCR clean up kit (Qiagen, MD). Amplicons were sequenced by MiSeq (Illumina ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 5×106 human PBMCs from Cohort II using AllPrep RNEasy kits (Qiagen) and the small RNA-containing column flow-through collected ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 male C57Bl/6 mice-derived pial tissue was extracted using RNeasy Micro Kit (Qiagen, #74034). After RiboGreen quantification and quality control by Agilent BioAnalyzer ...
-
bioRxiv - Biochemistry 2020Quote: ... and pJET_Luc_FL_UTR_REV (5’-GCAATGAAAATAAATGTTTTTTATTAGGCAGAATCCAAATGC-3’) primers and was purified with the QIAquick PCR Purification Kit (Qiagen) directly after the PCR reaction ...
-
bioRxiv - Genomics 2020Quote: ... before aliquoting into 5 tubes and proceeding with the Qiagen DNeasy Plant Mini Kit (Qiagen; 69104) protocol ...
-
bioRxiv - Biophysics 2022Quote: ... to dephosphorylate 5’ ends.Digested inserts were gel extracted using the QiaQuick gel extraction kit (Qiagen, Germany). Digested and 5’ dephosphorylated vector was purified using the QiaQuick PCR Cleanup kit (Qiagen ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA from 5 embryos was extracted using the RNeasy microRNA isolation kit (Qiagen, Valencia, CA), and the RNA samples were digested on-column with RNase-free DNase I to eliminate genomic DNA ...
-
bioRxiv - Genomics 2022Quote: We extracted RNA from 5 × 105 cells using the QIAGEN RNeasy Mini kit (Qiagen, cat # 74014) with DNase I treatment (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of each reaction mixture was used for amplification with the REPLI-g kit (Qiagen) at 16 °C overnight and cleaned with the DNA Clean & Concentrator kit to yield samples for sequencing ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was prepared from approximately 5×106 cells using the DNeasy-96 kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions ...
-
Immune profiling in M. tuberculosis infection enables stratification of patients with active diseasebioRxiv - Immunology 2019Quote: Supernatants from QFT and TruC tubes were analyzed for IFNγ by standard ELISA (Qiagen) and values were expressed in IU/mL ...
-
bioRxiv - Immunology 2020Quote: Ni-NTA plates (Qiagen) were loaded with 2 μg/mL of SARS-CoV-2 S protein in TBS for 2 h at RT ...
-
bioRxiv - Cancer Biology 2023Quote: ... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 12-273 BM cells at 80% confluence in 6 well plates using the RNeasy Mini Kit (Qiagen 74104). 600 ng of RNA was subjected to DNase I treatment and reverse transcription ...
-
bioRxiv - Genomics 2021Quote: ... in a 15 ul reaction volume in 96-well plates or with the Repli-g Single Cell kit (Qiagen) in a 10 ul reaction volume in 384-well plates ...
-
bioRxiv - Biochemistry 2020Quote: CYP124–SQ109 was crystallized by a sitting drop approach in 96-well crystallization plates with commercially available kits (Qiagen) at 20 °C with 1:1 protein/mother liquor ratio with the ligand concentration of 100 μM ...
-
bioRxiv - Cell Biology 2022Quote: Cells were seeded at 800,000 in 60 mm plates and 24 h later RNA was isolated (Qiagen RNeasy Kit). 1 ug of RNA was reverse transcribed (Applied Biosystem) ...
-
bioRxiv - Cell Biology 2022Quote: Cells were seeded at 800,000 in 60 mm plates and 24 h later RNA was isolated (Qiagen RNeasy Kit). 1 μg of RNA was reverse transcribed (Applied Biosystems™ High-Capacity cDNA Reverse Transcription Kit) ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA was isolated from cells in 96-well plates using the Qiagen FastLane Cell Probe Kit (QIAGEN, 216413), according to the manufacturer’s instructions to a final volume of 40 μL per well ...
-
bioRxiv - Cancer Biology 2019Quote: FTE cells were harvested from 6 cm plates and RNA was isolated using miRNAeasy micro kit (Qiagen, Hilden, Germany). Quantity and quality of total RNA was analyzed using Nanodrop (Thermo Scientific) ...
-
bioRxiv - Genomics 2019Quote: ... while the manual plate samples were processed using the Qiagen DNeasy PowerSoil HTP 96 kit (Qiagen, Cat# 12955-4).
-
bioRxiv - Genetics 2020Quote: ... Sample libraries were purified using a plate from a MinElute 96 UF PCR Purification Kit (QIAGEN Inc., Hilden, Germany), vacuum manifold ...
-
bioRxiv - Physiology 2023Quote: ... RNA was pooled from 3-4 wells of an MEA plate and then extracted using the miRNeasy kit (Qiagen). RNA levels were measured using the nanoString nCounter® PlexSet™ (nanoString ...
-
bioRxiv - Cell Biology 2022Quote: Cells were grown in 6 well plates and total mRNA was isolated using the RNeasy Kit (Qiagen, 74-104) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Genomic DNA (gDNA) was extracted from 1-5×106 cells using DNeasy Blood and Tissue Kit (Qiagen) and 250 ng gDNA ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmids were isolated from 5 mL of overnight liquid culture using QIAprep Spin Miniprep Kit (Qiagen, Germany) and the presence of mutations was confirmed by Sanger Sequencing.
-
bioRxiv - Synthetic Biology 2021Quote: mESC gDNA was purified from 1-5 million cells using the QIAamp DNA mini kit (Qiagen 51306) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA from 5×105 FACS sorted p7 MPs was isolated using the RNeasy Micro Kit (Qiagen). RNA quantity and quality was tested on a Qubit®Fluorometer (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 ng of each RNA was reverse transcribed to cDNA using the miRCURY reverse transcription kit (Qiagen). Qiagen’s miRCURY Locked Nucleic Acid (LNA ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA was extracted from approximately 5×105 CD133 purified progenitors using an RNeasy micro kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: ... RNA was isolated from 5-6 replicated lung slices from each treatment using miRNeasy Mini Kit (Qiagen) at time 0 and time 120 hours for all groups ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA was extracted from pools of 3-5 second leaves using the Plant RNAeasy kit (Qiagen) using manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 5 and 0.22 μm pore-size filters were processed using the DNeasy PowerWater Kit (QIAGEN, Hilden, Germany) following the manufacture instructions ...
-
bioRxiv - Plant Biology 2019Quote: RNA was extracted from leaves of 5-week-old Arabidopsis plants using RNeasy Mini extraction kit (Qiagen) and treated with Turbo DNA-free kit (Ambion ...
-
bioRxiv - Genomics 2021Quote: DNA was extracted from the donors’ peripheral blood (5 ml) using DNeasy Blood & Tissue Kit from QIAGEN according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Ligation of 1 µl 5′RACE PCR products were performed with the Qiagen PCR cloning kit (Qiagen) according to the manufacters protocol ...
-
bioRxiv - Immunology 2023Quote: ... cells pooled from n = 3 - 5 mice / cohort) was isolated using the RNeasy Plus Mini Kit (Qiagen). Clariom S microarray analysis (Affymetrix ...
-
bioRxiv - Genomics 2024Quote: RNA was extracted from 2-5 million flash frozen cells using the RNeasy plus mini kit (Qiagen). Libraries were prepared using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (New Englands Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... Sorted cells were then centrifuged (300xg, 5 min) before RNA isolation using the RNeasy Mini Kit (Qiagen), according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: RNA was extracted from neuron-astrocyte co-cultures at 5 weeks using RNeasy Mini kit (74104, Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: On day 5 of dietary exposure RNA was extracted via the Qiagen RNeasy Mini Kit (Qiagen 74104). Briefly ...
-
bioRxiv - Cell Biology 2022Quote: ... and oligo 5 (Q4) 5’-CACCGAGCTCTTCGCCGAGTA-3’ (Qiagen, SI03058272).
-
bioRxiv - Microbiology 2023Quote: ... 5 μL 5× One-step RT-PCR buffer (QIAGEN), 10 μL Triton-x100 (0.3% ...
-
bioRxiv - Microbiology 2023Quote: ... The plates were then loaded onto a TissueLyser II plate shaker (Qiagen, Germantown, MD), firmly secured ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Single cells of Desulfovibrio or Methanococcus were sorted into wells of a 96-well plate containing 3 µl of PBS and Buffer D2 from Repli-G single cell kit (Qiagen) by using Influx flow cytometer (BD) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Infected cells were grown for three days before combining the plates of each replicate for extraction of RNA and DNA via the Qiagen AllPrep mini kit (Qiagen). We subsequently purified mRNA from the RNA using the Oligotex mRNA prep kit (Qiagen ...
-
bioRxiv - Neuroscience 2019Quote: Total cellular RNA from HOTCs on multiple pooled plates was harvested from treated or control HOTCs using the RNeasy RNA Isolation Kit (Qiagen). RNA quality and quantity was analyzed with spectrophotometry and gel electrophoresis.
-
bioRxiv - Cancer Biology 2019Quote: ... was isolated from human PanNET specimens or cells grown on 6-cm or 10-cm plates using RNeasy mini kit (Qiagen) containing gDNA eliminator spin columns ...
-
bioRxiv - Developmental Biology 2021Quote: Organoids from a single 48-well plate well were used for genomic DNA extraction with QIAamp Fast DNA Tissue Kit (51404, Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... with the exception of larger HSPC colonies which were extracted using the DNeasy 96 blood and tissue plate kit (Qiagen) and then diluted to 1-5ng ...