Labshake search
Citations for Qiagen :
101 - 136 of 136 citations for 8 Benzoyloctanoicacid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: Total cellular RNA was extracted from 8-day-old wildtype or mutant seedlings grown on 1/2MS medium with RNeasy Mini Kit and QIAshredder (Qiagen). Three independently prepared samples with RNA integrity number greater than 8.0 from each line were sequenced and analyzed at The Centre for Applied Genomics at SickKids Hospital (Toronto ...
-
bioRxiv - Neuroscience 2022Quote: RNA from frozen FC area 8 was extracted following the supplier’s instructions (RNeasy Mini Kit, Qiagen® GmbH, Hilden, Germany). RNA integrity and 28S/18S ratios were determined with the Agilent Bioanalyzer (Agilent Technologies Inc ...
-
bioRxiv - Microbiology 2023Quote: ... pH was adjusted to 8 after resuspension to allow the binding of 6x His-tagged toxins to Ni-NTA agarose resin (reference: 30210; Qiagen). Resulting samples were passed through chromatography columns containing the Ni-NTA agarose resin and were eluted with denaturing buffer containing increasing concentrations of Imidazole (10 mM ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA was isolated from Arabidopsis seedlings (8 seedlings per sample) using the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) 24 h after the elicitor treatment ...
-
bioRxiv - Microbiology 2023Quote: ... and RNAI were amplified by PCR (primer sequences are listed Supplementary Table 8) and PCR products were analysed by 2 % agarose gel electrophoresis and purified using the QIAquick PCR purification kit (QIAGEN). 5’-triphosphate (PPP ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was generated as previously described.8 The cDNA and purified viral DNA were used for quantitative PCR (qPCR) using QuantiTect probe PCR master mix (Qiagen) and optimized concentrations of forward primer (TGTGTGGGAGACCATCAAGC) ...
-
bioRxiv - Microbiology 2023Quote: ... an unbiased amplification method was employed by amplifying the purified DNA at 30°C for 8 hours using a REPLI-g Single Cell kit (Qiagen). The amplified DNA was purified using AMPure XP magnetic beads (Beckman Coulter ...
-
bioRxiv - Genomics 2023Quote: ... After ligation nuclei were pelleted and resuspended in cold PBS with DAPI to a final concentration of 300nM and GFP+ cells were FAC-sorted into a 96 well plate with 2ul lysis buffer (20mM Tris pH 8, 20mM NaCl, 0.15% Triton X-100, 25mM DTT, 1mM EDTA, 500nM Carrier ssDNA, and 15ug/mL Qiagen Protease) and lysed for 1 hour at 50°C and inactivated 15 minutes at 70°C ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was isolated from flash frozen 8 μm thick sections of tibialis anterior muscles embedded in OCT using the RNeasy Mini Kit (Qiagen) and evaluated using the RNA high sensitivity kit (Agilent RNA 6000 Pico Kit ...
-
bioRxiv - Microbiology 2024Quote: ... mixed with 1 mL phenol:chloroform:isoamyl alcohol (25:24:1 at pH 8) at 70°C for 12 min and bead beating for 2 min (Tissue Lyser II, Qiagen). The mixture was centrifuged at 4°C for 3 min at maximum speed and the aqueous phase was transferred to a new reaction tube ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 75 ng of rRNA was reverse transcribed and amplified with 8 PCR cycles using the OneStep RT-PCR kit (Qiagen) and primers MS2_quant_F and MS2_quant_R (Supplemental Table 5) ...
-
bioRxiv - Microbiology 2024Quote: ... samples were resuspended in 100 μl TE buffer pH 8 and RNA extraction performed according to the RNeasy Mini Kit (Qiagen) protocol with few modifications ...
-
bioRxiv - Biochemistry 2023Quote: ... SUMO protease was added at a final concentration 1/10 and the mixture was dialyzed overnight at 4 °C against the buffer DB6 (50 mM Tris-HCl pH 8, 150 mM NaCl, 10 mM imidazole) and applied on a NiNTA column (Qiagen) equilibrated in the DB6 buffer ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA was extracted and 5 μg reverse transcribed from paired isolated Jz and Lz placental tissues (n = 8-10 per genotype/sex, across 11 litters) using the RNeasy Plus Mini Kit (Qiagen, DE) and the High-Capacity cDNA Reverse Transcription Kit minus RT inhibitor (Applied Biosystems ...
-
bioRxiv - Genetics 2021Quote: DNA was isolated from each of the 8 samples of flies using an adaptation of the Gentra Puregene Cell Kit protocol (Qiagen, 158767). Briefly ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNA was extracted from 32D-Cas9 cell lines expressing sgRNAs targeting Cbl introns 7 and 8 using an RNeasy Mini Kit (QIAGEN, 74106). cDNA was prepared using a QuantiTect Reverse Transcription Kit (QIAGEN ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... We extracted RNA from a total of 348 individuals across two early developmental stages (2 days post fertilization (dpf) and 8 dpf) using RNeasy Mini Kits (Qiagen, Inc.). For 2 dpf libraries ...
-
bioRxiv - Neuroscience 2020Quote: DNA and RNA from 8-10 mice was isolated and purified with AllPrep-DNA/RNA/miRNA-universal kit (Qiagen, Montreal, QC) and concentrations were determined by fluorometry on the Qubit system (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: At DIV 28-30 iPSC-MG from 8 C9orf72 ALS/FTD patient lines and 4 control lines were pelleted and lysed using QIAshredder (QIAGEN-79654) and RNA was isolated with RNeasy Mini Kit (QIAGEN-74104 ...
-
bioRxiv - Molecular Biology 2020Quote: ... pH 8) and the supernatant was incubated with 80 μl pre-washed Ni-NTA coated Sepharose beads (Ni-NTA agarose, (Qiagen, Hilden) for 90 mins at 4°C on a rolling incubator ...
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... pods from 8-10 different plants were pooled and RNA was isolated using RNAeasy plant mini kit (Qiagen, Germantown, MD, USA). RNA libraries were prepared using standard Illumina protocols and RNA sequencing was performed using NovaSeq 6000 PE150 by Novogene co ...
-
bioRxiv - Bioengineering 2023Quote: ... DNA was extracted in pools of 6-8 adult mosquitoes mosquitoes using Blood & Cell Culture DNA Midi Kit (Qiagen, Cat# 13343) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... Inclusion bodies were solubilized in 8 M guanidine hydrochloride (GdnHCl) and then PrP was captured using Ni-NTA Superflow beads (Qiagen #30410). Bead-bound PrP was refolded on-column using a 4 h gradient from 6 to 0 M GdnHCl and then eluted using a gradient from 0 to 500 mM imidazole ...
-
bioRxiv - Bioengineering 2019Quote: ... Up to ∼2 million cells were resuspended in 100 μl High-TE buffer (10 mM Tris-Cl, pH 8, 10 mM EDTA, 25-100 μg/ml RNase A (QIAGEN, Cat. # 19101)) and lysed by adding 2.5 μl 20% SDS ...
-
bioRxiv - Genetics 2022Quote: ... The PCR amplification was carried out in a 10-μl reaction volume containing 8 μl of Taq PCR Master Mix (Qiagen, Hilden, Germany), 10 μM of each primer (1 μl) ...
-
bioRxiv - Cancer Biology 2021Quote: DNA was isolated from 10-20 8-μm frozen tissue sections of biopsies from humanized mice using the PureGene DNA isolation kit (Qiagen, Hilden, Germany). PCR was performed with six framework region 1 subgroup specific primers and a JH primer mix (3’ JH mix ...
-
bioRxiv - Developmental Biology 2021Quote: ... from entire blastocysts (sibling day-8) was whole-genome amplified by multiple displacement amplification (MDA) with a REPLI-g Single Cell Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions with full or half reaction volumes for the fast 3-h protocol ...
-
bioRxiv - Microbiology 2020Quote: Total RNA extraction was performed using a squash buffer (10 mM Tris base, 1 mM EDTA, 50 mM NaCl) supplemented with 1:8 part Proteinase K (Qiagen, 15mg/ml). Mosquito abdomens with the midguts and heads with thoraces were individually collected in 50 μl of squash buffer at 7 and 14 days ...
-
bioRxiv - Microbiology 2022Quote: Fecal samples were collected from the Duroc piglets at 60□±□8 days of age and microbial DNA was extracted with the DNeasy PowerSoil Kit (QIAGEN, Hilden, Germany). Extracted DNA was sent to the University of Illinois Keck Center for paired-end (2□×□250 bp ...
-
bioRxiv - Molecular Biology 2023Quote: ... 600 µl of lysis buffer (TES (0.1 M TRIS, 10 mM EDTA, 2% sodium dodecyl sulphate; pH 8) and Proteinase K (Qiagen, 20 mg/ml) in a 20:1 ratio ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated by standard procedure from 20-30 heads of 8-day-old males collected on ice and lysed in 600 µl QIAzol Reagent (Qiagen, Venlo, Netherlands). 1 μg of total RNA was treated by DNase (DNase I ...
-
bioRxiv - Developmental Biology 2022Quote: ... Genomic DNA from 4-8 microdissected 10 μm FFPE sections were extracted using the QIAamp DNA FFPE Tissue kit (Qiagen, cat. no. 56404) according to manufacturer instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... About 30-40 flowers were pooled together from 8-10 different plants for each biological repeat and RNA was isolated using RNAeasy plant mini kit (Qiagen, Germantown, MD, USA). RNA was converted to cDNA using PrimeScript RT Master Mix (Takara) ...
-
bioRxiv - Neuroscience 2023Quote: ... A total of 400 ng an RNA with RNA integrity number (RIN) greater than 8 from each sample was processed with QIAseq Targeted RNA Mouse Cancer Transcriptome Panel (Qiagen, Germany, RMM-003Z). This panel consists of 416 genes selected for the association with angiogenesis ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA was extracted from homogenized tumor tissue samples (n=8 samples matching sampling time, Basel Ovarian Biobank) derived from patients using the DNeasy Blood & Tissue kit (QIAGEN, cat. no. 69504). Isolated DNA underwent QC using Nanodrop and Qubit measurements ...