Labshake search
Citations for Qiagen :
101 - 150 of 3110 citations for 7 Bromo 2 chloromethyl 4H pyrido 1 2 a pyrimidin 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl of inner PCR product was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 0.4 μl of 10 μM dNTP mix ...
-
bioRxiv - Microbiology 2022Quote: ... of the hamsters at 2 dpi or 2 days post-exposure (exposed naïve) using RNeasy kit (Qiagen) for viral load quantification and calculation of the Omicron:Delta ratio ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 mL samples were mixed into glass tubes containing 2 volumes of RNAprotect bacteria reagent solution (Qiagen). After mixing and incubating for 5 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: SARS-CoV-2 whole-genome sequencing was performed by using QIAseq DIRECT SARS-CoV-2 Kit (QIAGEN). The quality of paired-end reads obtained from MiSeq sequencing was analyzed by using Qiagen CLC Genomics Workbench 22.0.1 and the Identify ARTIC V3 SARS-CoV-2 Low Frequency and Shared Variants (Illumina ...
-
bioRxiv - Cancer Biology 2019Quote: ... HEK293 cells were transfected with 1:1:2 μg of packaging plasmids versus shRNA hairpins on the pLKO.1 vector using Effectene transfection reagent (Qiagen) 48 h prior to harvesting supernatants ...
-
bioRxiv - Biochemistry 2022Quote: ... Clarified lysate was then incubated for one hour at 4 °C with Ni-NTA (Qiagen) in batch adsorption format ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 mL of stabilization mix (RNAprotect Bacteria Reagent - Qiagen diluted with PBS in a 2:1 volume ratio) was applied on plates ...
-
bioRxiv - Biochemistry 2020Quote: ... 4°C) an applied to a 2 ml Ni-NTA immobilised metal affinity chromatography (IMAC) gravity flow column (QIAGEN, Hilden, Germany). Columns were washed in 10 column volumes (CV ...
-
bioRxiv - Genomics 2022Quote: ... Day 145) for n=4 clams for each treatment (Figure 2) using the Qiagen DNeasy Blood and Tissue Kit (Qiagen USA) according to manufacturer’s instructions with slight modifications ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and ∼55 mg of total protein in CFE was incubated for 60 min at 4 °C with 2 mL of Ni-NTA agarose (QIAGEN, Germany) equilibrated with purification buffer A ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were centrifuged at 5000 g for 2 hours at 4 °C and the pellet was collected for DNA extraction with a DNeasy PowerSoil kit (Qiagen, Germany). The sediment from Lime Blue was collected with a freeze core (modified from Stocker and Williams ...
-
bioRxiv - Biophysics 2023Quote: ... dCas9-Halo protein was purified from the supernatant by incubating for 2 h at 4 °C with Ni-NTA agarose (Qiagen #30210). The beads were washed 10 times with 5 ml dCas9 wash buffer I (50 mM NaxPO4 pH 7.0 and 300 mM NaCl ...
-
bioRxiv - Biophysics 2023Quote: ... dCas9-Cys protein was purified from the supernatant by incubating for 2 h at 4 °C with Ni-NTA agarose (Qiagen #30210). The beads were washed 10 times with 5 ml dCas9-Cys wash buffer (20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from CaCo-2 cells infected with SARS-CoV-2 using the RNeasy Mini kit (Qiagen) including an in-column DnaseI treatment step ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 ml of the non-stressed culture was added to 2 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 2 μL of 0.1 M Dithiothreitol (Qiagen), 1 μL of 10 mM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Genomics 2020Quote: Total RNA was extracted from 1–2 million cells using the AllPrep Mini kit (QIAGEN) according to the manufacturer’s instructions and 1 μg of total RNA was used to prepare each RNA-seq library ...
-
bioRxiv - Microbiology 2021Quote: ... and 1% penicillin–streptomycin) at 300 Hz for 2 min using a Tissuelyser II (Qiagen) and centrifuged to clarify the supernatant ...
-
bioRxiv - Microbiology 2022Quote: ... and 1% penicillin–streptomycin) at 300 Hz for 2 min using a Tissuelyser II (Qiagen) and were then centrifuged to clarify the supernatant ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mL of sample culture was immediately transferred into 2 mL RNA protect bacteria (QIAGEN) and vortexed ...
-
bioRxiv - Microbiology 2023Quote: ... we placed filters in 2 mL tubes with beads and 1 mL TE buffer (Qiagen plasmid isolation kit ...
-
bioRxiv - Biochemistry 2023Quote: Total RNA was extracted from 1 – 2 x 108 cells using the RNeasy kit (Qiagen). DNA was removed using Turbo DNase (Applichem ...
-
bioRxiv - Microbiology 2022Quote: ... 1 mL of the 2-mL culture was removed and replaced by 1 mL of RNAprotect Cell Reagent (Qiagen). After 5 min of incubation ...
-
bioRxiv - Microbiology 2022Quote: ... 200 RPM for 2 h then approximately 1×109 CFU of bacteria were mixed at a 2:1 (vol:vol) ratio of RNAProtect (Qiagen) and incubated at room temperature for 5 min ...
-
bioRxiv - Microbiology 2023Quote: TG was quantified in snap-frozen liver tissue stored at −80 □C until cryo-grinding in liquid nitrogen and 50 ±5 mg tissue added 0.9 mL of a 2:1 chloroform:methanol solution and homogenized 1 min at 50 os/sec using a TissueLyser LT (Qiagen) with beads ...
-
bioRxiv - Microbiology 2021Quote: ... Maize and soybean leaf and root tissue were pulverized for 2-min at a speed of 30 Hz with two 4-mm stainless balls in a TissueLyser II (Qiagen, Venlo, Netherlands). Total DNA was extracted from plant tissues with the OMEGA Mag-Bind Plant DNA Plus kit (Omega Bio-Tek ...
-
bioRxiv - Microbiology 2024Quote: ... The pellets were resuspended with OMV buffer and re-pelleted again by centrifugation at 100,000 g (31,000 RPM) for 2 h at 4°C and lysed with Qiazol followed by RNA isolation with the miRNeasy kit (Qiagen, Germantown, MD) to obtain total RNA including the small RNA fraction ...
-
bioRxiv - Bioengineering 2021Quote: ... PCR 2 products were purified by 1% agarose gel using a QIAquick Gel Extraction Kit (Qiagen), eluting with 15 μL of Elution Buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tissues were homogenized in a mixture of chloroform and methanol (2:1) using TissueLyser II (Qiagen) and dried in a Vacufuge (Eppendorf ...
-
bioRxiv - Immunology 2021Quote: DNA from 1-2 stool pellets was extracted using the QIAamp DNA Stool Mini Kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Cultures samples were then mixed 1:2 with RNA Protect Bacteria Reagent (QIAGEN, Germantown, Maryland, USA), vortexed immediately for 5 seconds and incubated for 5 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were then treated with DpnI for 1-2 hr and then purified (QiaQuick, Qiagen) before use in library construction.
-
bioRxiv - Microbiology 2023Quote: ... each spot was collected into a 1:2 mix of LBS and RNAprotect Bacteria reagent (Qiagen), incubated at RT for 5 minutes ...
-
bioRxiv - Systems Biology 2023Quote: ... About 1 OD/mL cells were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, 76506), and the cell pellet was collected by centrifuging at 2500 g for 8 minutes at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: One colony per clone corresponding to ∼2×104 cells and 2×103 primary cells of each individual were lysed in RLT Plus (Qiagen) and stored at −80°C until processing ...
-
bioRxiv - Neuroscience 2021Quote: Total brain RNA from 21 days old Itm2bD/D and Itm2bww/ rats (2 male and 2 females per each genotype) was extracted with RNeasy RNA Isolation kit (Qiagen). Standard RNA-Seq procedures and data analysis was performed by Genewiz following proprietary methods (https://cdn2.hubspot.net/hubfs/3478602/NGS/RNA-Seq/GENEWIZ_RNA-Seq_Technical_Specifications_US.pdf) ...
-
bioRxiv - Microbiology 2021Quote: Swab RNA was extracted from 0.2 ml of swab solutions (1ml of DMEM with 2% fetal bovine serum [Cytiva]) using QIAamp Viral RNA Minikit (QIAGEN) and subjected to real-time RT-PCR for viral RNA quantitation [40] using QuantiTect Probe RT-PCR Kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was isolated from cultures infected with rVSV/SARS-CoV-2/GFP1D7 and rVSV/SARS-CoV-2/GFP2E1 using the QIAamp Viral RNA mini kit (Qiagen) and cDNA synthesis was performed using SuperScript III using hexamers (ThermoFisher) ...
-
bioRxiv - Genetics 2021Quote: ... ThermoScientific catalog numbers A32955 and 78420)) using a bead mill with steel beads (2 x 2 min at 20 Hz; TissueLyser, Qiagen). Extracts were cleared by centrifugation (17,000 RCF ...