Labshake search
Citations for Qiagen :
101 - 150 of 4207 citations for 6H 1 3 Thiazin 6 one 2 ethoxy 4 hydroxy 5 nitro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and the mouse hippocampal tissues (n=5-6/group; Qiagen, Germantown, MD, USA). The samples of the RNA (500ng/µL ...
-
bioRxiv - Microbiology 2020Quote: ... vIL-6 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using QuantiTect Multiplex RT-PCR Kits (Qiagen) as described previously (37 ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 °C for 1 h and purified by affinity chromatography using a 5 ml Ni-HP column (Qiagen). Flow through with pure AstaPo1 was collected and dialyzed overnight against the buffer containing 50 mM Tris pH 7.6 ...
-
bioRxiv - Microbiology 2020Quote: ... CjNC110-LNA DIG-labeled probe (/5’DigN/ GCACATCAGTTTCAT/3’Dig_N/) (QIAGEN) was added to 15 mL DIG EasyHyb™ Buffer (Roche ...
-
bioRxiv - Systems Biology 2022Quote: ... 5 μl of proteinase K (approximately 3 U, Qiagen, cat. # 19131) were added and incubated for 1 h at 56°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen, #1027281). After 72 h ...
-
bioRxiv - Cell Biology 2023Quote: ... using 30 nM Hs_LUZP1 siRNA (target sequence, 5′-CAGCGGGTGCTGAGAATTGAA-3′; QIAGEN) or 30 nM AllStars negative-control siRNA (QIAGEN) ...
-
bioRxiv - Biochemistry 2024Quote: ... The remaining supernatant was centrifuged again at 5,000 x g for 20 minutes at 4°C and equilibrated for 1 hour in 3 mL of Ni-NTA resin (Qiagen) that was pre-equilibrated in the extraction buffer ...
-
bioRxiv - Physiology 2022Quote: ... Fifteen milligrams of liver were homogenized in 200 µL of a 3:3:2 solution of acetonitrile:isopropanol:water (MeCN:IPA:H2O) in ceramic bead tubes (1.4 mm, Qiagen #13113-50) using a TissueLyzer II (Qiagen #85300) ...
-
bioRxiv - Neuroscience 2023Quote: ... for 2 x 2 minute intervals at 25 Hz with the addition of one 7 mm stainless steel bead (Qiagen #69990). 200 uL of tissue lysate was used for KingFisher Flex (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... after hydroxy tamoxifen treatment cells were collected for genomic DNA extraction (DNeasy blood & tissue kit, Qiagen), 100-200 ng genomic DNA was treated with 16 U of the appropriate restriction enzyme overnight at 37°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA was extracted from cells (1-2 wells, 6 well plate) using an RNeasy Plus Mini Kit (Qiagen, Hilden, Germany), including a DNase step to remove residual DNA ...
-
bioRxiv - Microbiology 2024Quote: ... run using the QIAcuity One Digital PCR System (Qiagen, 2-plex Device, Cat. No. 911001). The following conditions were used for the one-step cycling dPCR program ...
-
bioRxiv - Microbiology 2024Quote: ... One µg of purified RNA was treated twice with 5 µl of RNAse-free DNAse (Qiagen) and subjected to a final on column purification ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... Plasmids of 5 µg were transfected into 6x10[6] S2 cells using Effectene (Qiagen) and incubated for 3 days ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% CA630) and rotated at 4°C for 2 hours before addition of His-beads (Ni-NTA, QIAGEN). After continuous rotating for another 2 hours ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... CCR6int and CCR6high subsets of CD4+ T cells were used for isolating RNA without and with prior activation with 20 ng/ml PMA and 1 mM ionomycin for 3 h at 37°C under 5% CO2 using RNeasy Mini Kit (Qiagen) and gene expression levels were determined using Illumina Human WG6 Expression BeadChip Version 3 arrays (Illumina Inc. ...
-
bioRxiv - Microbiology 2022Quote: ... 3 mL samples were added to tubes containing 6 mL RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and vortexed ...
-
bioRxiv - Microbiology 2023Quote: Lungs from hamsters at 4 or 6 dpi were homogenized in PBS with TissueRuptor (Qiagen). A part of the whole lung homogenate was subjected to plaque assays for virus titration as described above ...
-
bioRxiv - Cell Biology 2021Quote: The siRNA sequence (5’-GAGUAGAACUAGAAUGUGA-3’) targeting Hec1 was synthesized by Qiagen. The ON-TARGETplus SMARTpool siRNA sequences (5’-GAACGAGUAACCACAAUUA-3’) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected using siRNAs targeting MAD2 sequence 5′-AGAUGGAUAUAUGCCACGCTT-3′ (Qiagen), pools of siRNAs targeting the TP53 sequence 5’-GAAAUUUGCGUGUGGAGUA-3’ ...
-
bioRxiv - Genomics 2021Quote: ... The scramble-miR miRCURY LNA Detection probe (5’-GTGTAACACGTCTATACGCCCA-3’, YD00699004, QIAGEN) was used as a negative control ...
-
bioRxiv - Genetics 2020Quote: ... The 3’ and 5’ – DIG labeled miRCURY LNA miRNA Detection probes (Qiagen, negative control Scramble-miR cat ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 4-5 hours later DNA was transfected using Attractene (Qiagen). Briefly ...
-
bioRxiv - Neuroscience 2022Quote: ... CD11b+ CD45+ cells from one animal (2 retinas) were sorted directly into RLT buffer (QIAGEN 79216) and stored at -80°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... for a total of 6 min (2 x 3 min with 1 min on ice in between homogenisations) at 50 Hz using a TissueLyser LT (Qiagen). Thereafter ...
-
bioRxiv - Microbiology 2024Quote: ... used for DNA extraction of minipig blood and (NM-3) one negative control for the kit DNeasy PowerWater (Qiagen) used for the DNA extraction of water samples ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from 5 or 6 Transwells using the RNeasy Micro Plus kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 5-6 cryosections were also collected for RNA extraction using RNAeasy Micro kit (Qiagen, 74004). Quality of the RNAs was determined by Tapestation (Agilent ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria are harvested by centrifugation (5 minutes, 4°C) and washed with 1 ml cold PBS containing RNA stabilization reagents (RNAprotect, Qiagen) before flash freezing and storage at -80°C ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from pooled ipsilateral lumbar (L4-6) DRGs from one rat using the Qiagen RNeasy Mini Prep Kit (Qiagen, Valencia, CA) with on-column DNase digestion (Qiagen ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA isolated from 3-week-old thalli (QIAGEN RNAeasy Plant Kit 5) from each genotype was assessed for quality with a Nanodrop spectrophotometer and a Bioanalyzer 2100 microfluidics system (Agilent 6) ...
-
bioRxiv - Pathology 2021Quote: PDGFRα+ and CD56+ cells (passages 3 to 5) were lysed in Qiazol (Qiagen) followed by chloroform/isopropanol total RNA extraction ...
-
bioRxiv - Microbiology 2019Quote: ... Real-time PCR assays were carried out in triplicate to amplify the Wolbachia wsp gene [43] and host reference gene GAPDH (378 F_ 5’-CCGGTGGAGGCAGGAATGATGT-3’, 445 R_5’-CCACCCAAAAGACCGTTGACG-3’) on a Rotor-gene Q Instrument (Qiagen, NSW, Australia). Reactions were run in a total volume of 10 μl having 5 μl Rotor-Gene SYBR® Green PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... pools of 3 x 103 MPP1-4 were sorted directly into RLT buffer (Qiagen) enriched with 1% of β-mercaptoethanol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RNA from the original material used for next-generation sequencing of the serum and passage 3 cultured MRI103 virus was used as the template for amplification using the One-Step Ahead RT-PCR kit (Qiagen).
-
bioRxiv - Microbiology 2023Quote: ... and Chl523R (5’ CCY YMC GTA TTA CCG CAG CT 3’) targeting the 16S rRNA gene on a QIAcuity One digital PCR device (Qiagen) as recommended by the manufacturer ...
-
bioRxiv - Microbiology 2019Quote: ... from the ME phase and ES phase (1 ml) were added to 4 ml and 2 ml of RNAprotect Bacteria Reagent (Qiagen), respectively ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified extract was supplemented with 10 mM imidazole and rotated for 2 hours at 4 °C with 1 ml of Ni-NTA beads (Qiagen). Bound protein was eluted with 10 CV of buffer L / 200 mM imidazole ...
-
bioRxiv - Molecular Biology 2020Quote: ... Frozen samples were homogenized with zirconia beads YTZ-4 (AS-ONE, Osaka, Japan) using TissueLyser II (Qiagen, Hilden, Germany), and total RNA was then extracted using the Maxwell 16 LEV Plant RNA Kit (Promega ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lysates were clarified by additional centrifugation at 14,000 xg for 30 minutes and supernatants were incubated 1 hour at 4 °C with 5 mL of His-Pur™ Ni-NTA resin (Qiagen) previously washed 3 times with 25 mL of Lysis Buffer ...
-
bioRxiv - Cancer Biology 2023Quote: 2 × 105 cells were reverse-transfected in 6-well plates with Flexitube siRNA constructs (Qiagen) targeting KEAP1 (KEAP1_5 or KEAP1_8) ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 male C57Bl/6 mice-derived pial tissue was extracted using RNeasy Micro Kit (Qiagen, #74034). After RiboGreen quantification and quality control by Agilent BioAnalyzer ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from 4-6 dpf zebrafish larvae using the RNeasy Plus Micro Kit (Qiagen). cDNA was synthesized using the SuperScript III First-Strand Synthesis System (Invitrogen) ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice received either miRCURY LNA power inhibitor for mmu-miR-335-5p (Ant-335; sequence: 5’-CATTTTTCGTTATTGCTCTTG-3’; Qiagen, Cat No.: 339132; 0.1 nmol in 2 μL PBS), or a non-targeting scrambled control (Scr ...
-
bioRxiv - Neuroscience 2022Quote: ... and 18S rRNA (5’-GAG CGA AAG CAT TTG CCA AG-3’ and 5’-GGC ATC GTT TAT GGT CGG AA-3’) on a Roter-Gene Q (Qiagen, Hilden, Germany) with 2x AmpiGene® qPCR Green Mix Lo-ROX (Enzo Biochem ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA from patient material (n=3) and organoids (p1 and p2 n=3, p3 n=2) was extracted (RNeasy™ Mini Kit, Qiagen). To obtain cDNA ...
-
bioRxiv - Immunology 2019Quote: ... longitudinal muscle/myenteric plexus preparations were homogenized in a 2 ml eppendorf containing 1 ml Trizol and a single 5 mm steel bead in a TissueLyzer (Qiagen) for 3 min at 30 Hz ...
-
bioRxiv - Synthetic Biology 2020Quote: ... ~5×108 cells (1 ml of OD600 0.5) were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and pelleted ...