Labshake search
Citations for Qiagen :
101 - 150 of 1136 citations for 6 oxopiperidine 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... template switching (5’- AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3’, Qiagen), and ISPCR (5’-AAGCAGTGGTATCAACGCAGAGT-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349, Qiagen), and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL11m siRNA 5’-AGGAAGGAGGTCACACCAATA-3’ (SI04135684, Qiagen), mL65 siRNA 5’CAAGCUAUGUAUCAAGGAUtt3’ (s21375 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL16m siRNA: 5’ TACGGAGTTTACAGAAGGCAA-3’ (SI00648291, Qiagen) and Negative control siRNA (SI03650318 ...
-
bioRxiv - Cell Biology 2023Quote: ... MRPL45 siRNA: 5’-CTGGAGTATGTTGTATTCGAA-3’ (SI00649005, Qiagen), bL27m siRNA 5’CAGGCAGACGCCAAGGCATTA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647, Qiagen), uL16m siRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Cell Biology 2023Quote: ... bL31m siRNA 5’-CCAGGCTTATGCACGACTCTA-3’ (SI00649271, Qiagen), mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349 ...
-
bioRxiv - Genomics 2023Quote: Twenty 3 mm disc punches (UniCore, Qiagen) from each leaf sample were placed in mini-tubes with a 3 mm ball bearing ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 3 μL Vapor-Lock (Qiagen, 981611). Plates after sorting were briefly centrifuged ...
-
bioRxiv - Cell Biology 2020Quote: ... For SAS-6 knock down experiments siNegative control (siNegative, Qiagen, 1027310) and siSAS-6 (siSAS6 on-TARGET smart pool ...
-
bioRxiv - Plant Biology 2022Quote: ... 6 or 24 h using an RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: RNA interference against MUS81 was performed using FlexiTube HsMUS81 6 (Qiagen) at final concentration of 10 nM using Lullaby 48 h before to perform experiments ...
-
bioRxiv - Developmental Biology 2024Quote: ... 6×105 cells were resuspended in 600 µl RLT buffer (Qiagen) and snap frozen on dry ice for later processing ...
-
bioRxiv - Microbiology 2020Quote: Nucleic acids were extracted using the AllPrep DNA/RNA Micro kit (Qiagen) for simultaneous purification of minute amounts of DNA and RNA from the same sample without making use of the carrier RNA ...
-
bioRxiv - Microbiology 2019Quote: Nucleic acid extraction was performed with Advanced XL EZ1 (Qiagen, Hilden, Germany). The digestion step using proteinase K was performed for 10 minutes at 56 °C and 10 minutes at 95 °C followed by purification with EZ1 Tissue card according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... Total nucleic acid was extracted with QIAcube HT system (Qiagen, Valencia, Calif.), according to the manufacturer’s instructions for tissue or insects ...
-
bioRxiv - Cell Biology 2020Quote: ... the resulting supernatant was incubated with nickel-nitrilotriacetic acid agarose beads (QIAGEN) pre-equilibrated with the washing buffer (20 mM HEPES ...
-
bioRxiv - Biochemistry 2021Quote: ... Cleared lysate was incubated with Ni-nitrilotriacetic acid (NTA) resin from Qiagen for 1hr at RT ...
-
bioRxiv - Zoology 2021Quote: Nucleic acids were extracted using a QIAamp MinElute Virus Spin Kit (QIAGEN) and used to construct the sequencing libraries ...
-
bioRxiv - Microbiology 2020Quote: ... then the nucleic acid was purified using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Viral ribonucleic acid (RNA) was extracted by viral RNA kit (Qiagen, Germany), reversed by reverse transcription kit (Promega ...
-
bioRxiv - Biochemistry 2022Quote: ... Ni(II)-nitrilotriacetic acid agarose (Ni-NTA) resin was purchased from Qiagen. L-Allylglycine was purchased from Cayman Chemical Company ...
-
bioRxiv - Molecular Biology 2022Quote: ... the His-SUMO conjugates were enriched using nickel-nitrilotriacetic acid beads (Qiagen). Upon multiple washing steps ...
-
bioRxiv - Molecular Biology 2022Quote: ... 100 µL of dry nickel-nitrilotriacetic acid-agarose (Ni-NTA) beads (QIAGEN), were equilibrated with Guanidinium buffer supplemented with 5 mM β-mercaptoethanol and 50 mM Imidazole pH 8.0 ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by purification using nickel-nitrilotriacetic acid (Ni-NTA) agarose resin (QIAGEN). The recombinant protein was desalted with PD-10 column (SephadexTM G-25M ...
-
bioRxiv - Genomics 2019Quote: ... Plasma DNA was extracted using the QiaAmp Circulating Nucleic Acids kit (Qiagen). DNA was extracted from FFPE ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 1 μM Locked Nucleic Acid (LNA) oligo-d(T)30 (Qiagen) in primary-probe hybridization buffer composed of 40% formamide (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... Nucleic acids were extracted with the QIAamp Viral RNA mini kit (QIAGEN) to be further randomly amplified using a modified Whole Transcriptome Amplification 2 (WTA2 ...
-
bioRxiv - Microbiology 2021Quote: ... the supernatant was extracted with a nickel-nitrilotriacetic acid-agarose suspension (Qiagen) or a Pierce GST Spin Purification Kit (Thermo ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 μL of dry nickel-nitrilotriacetic acid-agarose (Ni-NTA) beads (QIAGEN), were equilibrated with Guanidinium buffer supplemented with 5 mM β-mercaptoethanol and 50 mM Imidazole pH 8.0 ...
-
bioRxiv - Biophysics 2023Quote: ... GlpG in supernatant was purified using nickel-nitrilotriacetic acid (Ni-NTA, Qiagen) affinity chromatography in 50 mM Tris-HCl buffer (pH 8.0 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was extracted using nucleic acid isolation kit (AllPrep® Qiagen) according to protocol instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant proteins were purified over nickel-nitrilotriacetic acid (Ni-NTA) Agarose (Qiagen). Therefore ...
-
bioRxiv - Biochemistry 2023Quote: ... the clarified supernatant was incubated with nickel-nitrilotriacetic acid agarose resin (QIAGEN) for 3 hours at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... Monovalent IgG was further purified by Ni- nitrilotriacetic acid (Ni-NTA) (Qiagen) column and then size exclusion column (superdex 200 ...
-
bioRxiv - Biochemistry 2023Quote: ... for GST-tagged proteins or nickel– nitriloacetic acid (Ni-NTA) agarose (Qiagen) for His-tagged proteins (2 hr ...
-
bioRxiv - Bioengineering 2024Quote: ... the supernatant was incubated with Ni-nitrilotriacetic acid (NTA) agarose resin (Qiagen) for 1 hour at 4 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... Nickel-nitrilotriacetic acid (Ni-NTA) resin was obtained from Qiagen (Valencia, CA). Stain free gels (4-12% ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted from 3 knockout and 3 littermate control samples using the QIAGEN RNeasy Micro Kit (QIAGEN 74004) according to the manufacturers protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Immunology 2021Quote: ... from P0 Tbx1LacZ/+Crkl+/- (n=3) and their wildtype littermates (n=3) were sorted and fixed using RNAprotect Cell Reagent (Qiagen) for storage before sample submission to the Oxford Genomics Centre ...
-
bioRxiv - Molecular Biology 2021Quote: ... Oligonucleotides containing shRNA inserts were PCR-amplified with primers 5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’ and 5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ and purified with QIAquick PCR Purification Kit (Qiagen). shRNA inserts and miRE18_LT3GEPIR_Ren714 backbone (inducible via Tet-On system ...
-
bioRxiv - Microbiology 2021Quote: ... samples were thawed and homogenized with a single 3 mm Eliminase washed stainless steel ball bearing in for 3 min at 30 Hz (TissueLyser II, Qiagen) then purified by the Direct-zol RNA microprep kit (Zymo).
-
bioRxiv - Cell Biology 2021Quote: Total RNA from HGC (3 x 107 cells) and SPZEJ (3-30 x 107 cells) was extracted with the RNeasy Plus Mini Kit (Qiagen), and the purity and concentration of the extracted RNA was evaluated with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...