Labshake search
Citations for Qiagen :
101 - 150 of 2305 citations for 6 Fluoro 1 3 benzodioxene 8 carbonyl chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... siMad2 (5’-CUGAAAGUAACUCAUAAUCUA -3’) (Qiagen). For transfection of the scFv or scFvC plasmids ...
-
bioRxiv - Microbiology 2019Quote: ... 8 ml of bed volume of Ni-NTA resin (Qiagen, Germany) was added and incubated for one hour with gentle agitation ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Sequences were manually curated with CLC Main Workbench 8 software (Qiagen) before being aligneed with the Muscle program implemented in the workbench to generate haplotypes by line for each intron ...
-
bioRxiv - Genomics 2021Quote: ... 8 and 10 of differentiation as recommended (RNAeasy Minikit. Qiagen 74106). Mineralized nodule formation was measured by staining cultures with Alizarin Red (40 mM ...
-
bioRxiv - Microbiology 2022Quote: ... and lysate was passed over 8 mL Ni-NTA resin (Qiagen) using gravity chromatography ...
-
bioRxiv - Immunology 2023Quote: ... and disrupted for 8 minutes in 300 μL ATL buffer (Qiagen) using a Qiagen Tissuelyser at 50Hz with a ceramic bead (MPBio) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 8 wells of cell death control (Qiagen AllStars Positive Control siRNA), and 8 wells of YAP targeting siRNA (Ambion Silencer Select ...
-
bioRxiv - Microbiology 2024Quote: ... Supernatant was passed over 8 ml of Ni-NTA resin (Qiagen), and the resin was washed with 70 ml of lysis buffer supplemented to 1 M NaCl followed by 20 ml lysis buffer ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA was extracted from cells (1-2 wells, 6 well plate) using an RNeasy Plus Mini Kit (Qiagen, Hilden, Germany), including a DNase step to remove residual DNA ...
-
bioRxiv - Genetics 2021Quote: ... S2 cells were seeded at 1 × 106 cells/ml in a 6-well plate and transfected using Effectene (Qiagen, Germantown, MD). For mobility shift assay (Figure 4) ...
-
bioRxiv - Immunology 2023Quote: DNA was extracted from 1×10^6 CD4 Th cells/ replicate using the Qiagen DNA mini kit according to manufacturer’s instructions (Qiagen Hilden, Germany). DNA was extracted from 10ng of mouse brain tissue as previously described13 using NEB Monarch High molecular weight DNA extraction kit according to manufacturer’s instructions (NEB Cat #T3050).
-
bioRxiv - Molecular Biology 2023Quote: ... An A base was added to the 3’ ends with Klenow (3’-4’ exo-) (Qiagen). The processed ds-cDNA was then ligated to Illumina sequencing adapters with T4 DNA Ligase (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: ... beat-beading tubes were filled 1/3 with beads and soaked overnight in 500 μl buffer RLT (Qiagen). Tubes were spun at full speed and excess buffer removed ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNAs were prepared from livers of rats subjected to inhalational anesthesia with sevoflurane or desflurane for 6 hours or less than 1 minute using an RNeasy Midi Kit (QIAGEN, Venlo, Netherlands) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... NG1 (5’ACCGACCACAGGGGG-3’) and NG2 (5’-GGTTGTAAACCTCTTTCGA-3’) and HotStarTaq® Master Mix Kit (Qiagen) up to a final volume of 25 μL ...
-
bioRxiv - Microbiology 2020Quote: ... and 8 h post-infection) using the QIAamp DNA micro kit (QIAGEN). As a parallel control ...
-
bioRxiv - Neuroscience 2023Quote: ... gcy-8 mRNA was detected using a OneStep RT-PCR kit (QIAGEN) from 3 ng of template RNA ...
-
bioRxiv - Cell Biology 2021Quote: ... si-FAU (5’-CCGGCGCUUUGUCAACGUUGU-3’, Qiagen), si-uS19 (5’-UCACCUACAAGCCCGUAAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-eS4X (5’-CUGGAGGUGCUAACCUAGGAA-3’, Qiagen), si-FAU (5’-CCGGCGCUUUGUCAACGUUGU-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Microbiology 2020Quote: Each dissected compartment (legs and thoraxes) was homogenized individually 3 x 1 minute at 30 Hertz using TissueLyser (Qiagen) and glass beads (#11079110 ...
-
bioRxiv - Neuroscience 2021Quote: ... miR-67 (miR control) or empty vector at a ratio of 1:3 using a lipofection protocol (Effecten, Qiagen) and processed at DIV15 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 9-10 mL of Buffer BB (1/3 of the lysate volume, From QIAGEN Plasmid Plus Midi Kit) was added ...
-
bioRxiv - Bioengineering 2023Quote: Each body part (legs and thorax) was homogenized individually for 3 × 1 minute at 30 Hertz using TissueLyser (Qiagen) and glass beads (#11079110 ...
-
bioRxiv - Immunology 2024Quote: Total RNA from roughly 1-3 million thawed patient PBMCs was extracted using a RNeasy Mini Extraction kit (Qiagen) and reverse transcribed to cDNA using oligo-DT primers and the iScript cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Genomics 2022Quote: ... 400 nL of protease mix (6 μg protease (Qiagen, 19155), 6.25x NEBuffer 4 (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... 6 and 9 employing the RNeasy plant mini kit (Qiagen). RNA was quantified using Nanodrop (Thermo Fisher ...
-
bioRxiv - Cell Biology 2023Quote: ... For MUS81 interference it was used FlexiTube HsMUS81 6 (Qiagen). SMARCAL1 was depleted using the MISSION esiRNA HUMAN SMARCAL1 (Sigma-Aldrich) ...
-
bioRxiv - Systems Biology 2023Quote: ... 6 million PBMCs were lysed using QIAzol Lysis Reagent (Qiagen). Samples were stored at -80°C until RNA extraction ...
-
bioRxiv - Cell Biology 2023Quote: ... 6 µg C19orf43 (purified from E. coli BL21 through Qiagen Ni-TA agarose using standard procedures ...
-
bioRxiv - Biochemistry 2023Quote: ... 6 mL of Ni2+-NTA slurry (Qiagen, Venlo, LI, Netherlands) were equilibrated in a gravity flow column with Wash Buffer (50 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2023Quote: ... UniSpike 6 (included in the QIAGEN miRCURY LNA RT Kit) to verify the efficacy of reverse transcription (RT ...
-
bioRxiv - Physiology 2022Quote: ... Fifteen milligrams of liver were homogenized in 200 µL of a 3:3:2 solution of acetonitrile:isopropanol:water (MeCN:IPA:H2O) in ceramic bead tubes (1.4 mm, Qiagen #13113-50) using a TissueLyzer II (Qiagen #85300) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 5mM EDTA (pH 8) together with a 5 mm stainless steel bead (Qiagen) and macerated at 1,200 rpm for 2 mins in the Geno/grinder followed by a 10-minute centrifugation (17,000 x g ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... After 8 h we isolated total RNA using a RNeasy Plus minikit (Qiagen). 384 TruSeq Stranded mRNA libraries were prepared in 96 sample batches ...
-
bioRxiv - Developmental Biology 2020Quote: ... HF n=8) using the Qiagen RNeasy Plus Mini Kit (Qiagen, Toronto ON). RNA was quantified by spectrophotometry (DeNovix ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 8) and 30 μl of 20 mg/ml Proteinase K (QIAGEN 19131) were added to the tissue/cell sample and incubated at 55°C overnight ...
-
bioRxiv - Bioengineering 2022Quote: ... cDNA was pooled and 8 ng was combined with SYBR Green Mastermix (Qiagen) for aliquoting into a 384-well RT2 Profiler PCR Array with genes from the Mouse Inflammatory Response and Autoimmunity set (Qiagen) ...
-
bioRxiv - Bioengineering 2020Quote: Around 250 mg of each produce sample was cut into 1-3 mm pieces using a scalpel and then processed with the DNeasy Powersoil Pro kit (Qiagen) to isolate 50μL of eluted DNA ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was purified 1-3 dpi from mock- or POWV-infected hBMECs or hPCs using RLT lysis buffer and RNeasy columns (Qiagen). Purified RNA was quantitated ...
-
bioRxiv - Genomics 2022Quote: ... Formalin-Fixed Paraffin-Embedded (FFPE) tissue (3 samples) and fresh frozen tissue (1 sample, QiaAmp Blood mini kit, QIAcube, QIAgen). Two samples are reference samples (NA24385 and NA12892 ...
-
bioRxiv - Genomics 2022Quote: ... the supernatants were mixed with Sigma HIS-Select Nickel Affinity Gel (at a ratio of 3:1) equilibrated in lysis buffer before being added into a polypropylene column (Qiagen). After extensive washing with a cold lysis buffer ...
-
bioRxiv - Cancer Biology 2022Quote: Spheroid and monolayer samples (technical replicates n=3) of MUC-1 and NCI-H295R cells were processed for RNA extraction using the RNeasy Mini kit (Qiagen), followed by DNA removal (TURBO DNA-free™ Kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA was extracted from pooled (n=10) embryonic zebrafish and pooled (n=3) adult (> 1 year) heart samples by QIAGEN RNEasy Lipid Tissue Extraction kit according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: Bacterial RNA was isolated from LB cultures at OD600nm 1 and 3 in biological replicates using the QIAzol lysis reagent (Qiagen). The quantity of the bacterial RNA samples was measured on a NanoDrop ND1000 system and their quality analyzed on the Agilent 2100 Bioanalyzer system with the Agilent RNA 6000 Nano kit protocol (Agilent Technologies) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The LNA gapmers for lnc-FLii-1 and lnc-LSAMP-3 were designed and purchased along with negative control LNA from Qiagen. For transfection ...
-
bioRxiv - Molecular Biology 2021Quote: ... for a total of 6 min (2 x 3 min with 1 min on ice in between homogenisations) at 50 Hz using a TissueLyser LT (Qiagen). Thereafter ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... CCR6int and CCR6high subsets of CD4+ T cells were used for isolating RNA without and with prior activation with 20 ng/ml PMA and 1 mM ionomycin for 3 h at 37°C under 5% CO2 using RNeasy Mini Kit (Qiagen) and gene expression levels were determined using Illumina Human WG6 Expression BeadChip Version 3 arrays (Illumina Inc. ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Biochemistry 2024Quote: ... The remaining supernatant was centrifuged again at 5,000 x g for 20 minutes at 4°C and equilibrated for 1 hour in 3 mL of Ni-NTA resin (Qiagen) that was pre-equilibrated in the extraction buffer ...