Labshake search
Citations for Qiagen :
101 - 150 of 1538 citations for 6 Chloroquinoline 2 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... followed by purification using nickel-nitrilotriacetic acid (Ni-NTA) agarose resin (QIAGEN). The recombinant protein was desalted with PD-10 column (SephadexTM G-25M ...
-
bioRxiv - Genomics 2019Quote: ... Plasma DNA was extracted using the QiaAmp Circulating Nucleic Acids kit (Qiagen). DNA was extracted from FFPE ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 1 μM Locked Nucleic Acid (LNA) oligo-d(T)30 (Qiagen) in primary-probe hybridization buffer composed of 40% formamide (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... Nucleic acids were extracted with the QIAamp Viral RNA mini kit (QIAGEN) to be further randomly amplified using a modified Whole Transcriptome Amplification 2 (WTA2 ...
-
bioRxiv - Microbiology 2021Quote: ... the supernatant was extracted with a nickel-nitrilotriacetic acid-agarose suspension (Qiagen) or a Pierce GST Spin Purification Kit (Thermo ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 μL of dry nickel-nitrilotriacetic acid-agarose (Ni-NTA) beads (QIAGEN), were equilibrated with Guanidinium buffer supplemented with 5 mM β-mercaptoethanol and 50 mM Imidazole pH 8.0 ...
-
bioRxiv - Biophysics 2023Quote: ... GlpG in supernatant was purified using nickel-nitrilotriacetic acid (Ni-NTA, Qiagen) affinity chromatography in 50 mM Tris-HCl buffer (pH 8.0 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was extracted using nucleic acid isolation kit (AllPrep® Qiagen) according to protocol instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant proteins were purified over nickel-nitrilotriacetic acid (Ni-NTA) Agarose (Qiagen). Therefore ...
-
bioRxiv - Biochemistry 2023Quote: ... the clarified supernatant was incubated with nickel-nitrilotriacetic acid agarose resin (QIAGEN) for 3 hours at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... Monovalent IgG was further purified by Ni- nitrilotriacetic acid (Ni-NTA) (Qiagen) column and then size exclusion column (superdex 200 ...
-
bioRxiv - Biochemistry 2023Quote: ... for GST-tagged proteins or nickel– nitriloacetic acid (Ni-NTA) agarose (Qiagen) for His-tagged proteins (2 hr ...
-
bioRxiv - Bioengineering 2024Quote: ... the supernatant was incubated with Ni-nitrilotriacetic acid (NTA) agarose resin (Qiagen) for 1 hour at 4 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... Nickel-nitrilotriacetic acid (Ni-NTA) resin was obtained from Qiagen (Valencia, CA). Stain free gels (4-12% ...
-
bioRxiv - Neuroscience 2020Quote: ... and 6 h prior to RNA extraction with the RNeasy Minikit (Qiagen). Equal amounts were reverse transcribed via the QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Neuroscience 2021Quote: ... 30s at 60°C on the Rotor-Gene Q 6-plex (QIAGEN). Mitochondrial copy number was calculated using the equation 2 × 2ΔCt ...
-
bioRxiv - Cell Biology 2022Quote: ... and 6×His-Flag-Ub was conducted using Ni-NTA agarose (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... for 6 hours before RNA extraction using the RNeasy Mini kit (Qiagen). Complementary DNA (cDNA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 6 and 8 dpi using Qiazol and the RNeasy mini kit (Qiagen). Purified RNAs were processed using Turbo DNase (Ambion DNAfree kit) ...
-
bioRxiv - Biophysics 2021Quote: ... Supernatant was collected for 2.5 h binding with Ni-nitrilotriacetic acid resins (Qiagen) at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... His6-AHCY was isolated by Ni2+-nitrilotriacetic acid (Ni-NTA) affinity chromatography (Qiagen) using standard procedures and eluted with 50 mM Tris buffer pH 8.0 ...
-
bioRxiv - Genomics 2019Quote: ... cfDNA was extracted from plasma using the QIAamp Circulating Nucleic Acid Kit (Qiagen) following the manufacturer’s protocol with minor modifications ...
-
bioRxiv - Biochemistry 2019Quote: ... The supernatant was mixed with nickel-nitrilotriacetic acid agarose beads (Qiagen, Hilden, Germany) and loaded on a column ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... cfDNA was extracted from plasma using the QIAamp circulating nucleic acid kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The remaining lysates were incubated with nickel-nitriloacetic acid (Ni-NTA) beads (Qiagen) for 1.5 h at 4°C ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant was mixed with nickel-nitrilotriacetic acid agarose beads (Qiagen, Hilden, Germany) and loaded on a column ...
-
bioRxiv - Plant Biology 2020Quote: ... Recombinant proteins were affinity purified using nickel-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen) and elution with imidazole ...
-
bioRxiv - Genomics 2021Quote: ... Nucleic acids were extracted using a QIAGEN DNeasy (DNA) kit (Qiagen Hilden, Germany). Three de novo genome sequencing methods were performed on the liver fluke ...
-
bioRxiv - Microbiology 2022Quote: Nucleic acids were extracted from samples using a DNeasy PowerSoil kit (Qiagen, Germany) and quantified using the Quant-IT PicoGreen assay kit (Invitrogen ...
-
bioRxiv - Physiology 2020Quote: ... DNA from plasma was extracted with the QIAamp Circulating Nucleic Acid Kit (Qiagen).
-
bioRxiv - Biochemistry 2019Quote: ... The protein was isolated by Ni2+-nitrilotriacetic acid (Ni-NTA) affinity chromatography (Qiagen). Proteins were eluted with 50 mM Tris buffer pH 7.5 ...
-
bioRxiv - Genomics 2021Quote: ... Amino acid sequences were aligned using CLC Genomics Workbench 20.0.04 (QIAGEN, Aarhus, Denmark).
-
bioRxiv - Genomics 2021Quote: Nucleic acids were extracted by homogenizing tissues using a TissueLyser II (Qiagen, 85300) followed by the AllPrep DNA/RNA/miRNA Universal Kit (Qiagen ...
-
Epigenetic alterations underlie airway macrophage differentiation and phenotype during lung fibrosisbioRxiv - Immunology 2020Quote: Nucleic acids were extracted from cells using the AllPrep Mini Kit (QIAGEN, Germany). DNA quality and quantity were assessed using Genomic DNA ScreenTape and TapeStation System (Agilent ...
-
bioRxiv - Genomics 2020Quote: ... Chondrocytes were transfected in duplo with antisense locked nucleic acid (LNA) GapmeR (Qiagen) targeting P3H2-AS1 (TGAGCAACTAGGTGTA ...
-
bioRxiv - Cell Biology 2021Quote: ... The soluble recombinant protein was purified using theNickel-Nitrilotriacetic acid (Ni-NTA+; Qiagen) resin ...
-
bioRxiv - Cancer Biology 2023Quote: ... all proteins were purified using Ni-NTA (nickel-nitrilotriacetic acid) resin from QIAGEN. After the incubation of Expi293 media supernatant with the Ni-NTA resin ...
-
bioRxiv - Cell Biology 2023Quote: ... The proteins were first purified using nickel-nitrilotriacetic acid (NTA) agarose resin (Qiagen), and the His8-SUMO tag was then removed by TEV protease (10:1 w/w ...
-
bioRxiv - Microbiology 2023Quote: ... viral nucleic acids were extracted using the QIAamp Viral RNA Mini Kit (QIAGEN GmbH ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated with Ni-nitrilotriacetic acid (Ni-NTA) resin (Qiagen, Germany) on a rocker for 1 hour at 4° C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... after which the chemokine was purified using nickel-nitrilotriacetic acid (NTA) resin (Qiagen). Purified CCL5 was refolded by first adding 4mM DTT to the eluate at pH>7 ...
-
bioRxiv - Microbiology 2023Quote: ... Bacterial nucleic acid was extracted using the EZ1 DNA tissue kit (Qiagen, Germany) on EZ1 Advanced XL (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: Locked nucleic acid (LNA) GapmeR ASOs were custom-designed and purchased from Qiagen, USA ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were harvested 6 h post-transfection and the extracted RNA (RNeasy, Qiagen) reverse transcribed to produce cDNA (QuantiTect ...
-
bioRxiv - Cell Biology 2020Quote: ... in the wells of 6 well plates (35mm) using Effectene transfection reagent(Qiagen) according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2019Quote: ... 6 and 9 hours of treatment using RNeasy Plus Mini Kit (Qiagen, 74134), and was reverse-transcribed to cDNA using Transcriptor First Strand cDNA Synthesis Kit with random primers (Roche ...
-
bioRxiv - Genetics 2019Quote: Raw sequence files (FASTQ) were imported into CLC Genomics Workbench (v.6; Qiagen) and mapped onto the human genome (GRCh37/hg19) ...