Labshake search
Citations for Qiagen :
101 - 150 of 858 citations for 6 Bromo benzo c isothiazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: 1.5×105 Acanthamoeba castellanii cells were transfected with 6 μg of linearized plasmid using Polyfect (QIAGEN) in phosphate saline buffer (PBS) ...
-
bioRxiv - Microbiology 2022Quote: 1.5×105 Acanthamoeba castellanii cells were transfected with 6 μg of each plasmid using Polyfect (QIAGEN) in phosphate saline buffer (PBS) ...
-
bioRxiv - Genetics 2023Quote: ... and 6 were performed to extract RNA using the RNeasy Plus Universal Kit (Qiagen, Hilden, Germany) and protein using an SMA enzyme-linked immunosorbent assay (ELISA ...
-
bioRxiv - Immunology 2023Quote: ... Transfection of siRNA was performed overnight using 6 nM for each siRNA with HiPerFect reagent (QIAGEN) according to the manufacturer’s reverse transfection protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... Bulk tumor-bearing tissues were homogenized in 6 ml of cell lysis buffer (Puregene, 158063, Qiagen) using a FastPrep-24 5G tissue homogenizer (116005500 ...
-
bioRxiv - Biochemistry 2024Quote: ... Proteins modified with 6×-His-Ub was purified using Ni-NTA Sepharose (142350243, Qiagen, Alameda, CA) on a rotating platform for 2 hours at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... coli cells grown overnight at 30°C (Plasmid Mini Kit, QIAGEN), and its concentration measured by nanodrop ...
-
bioRxiv - Genetics 2021Quote: ... Tissue was lysed at 55°C in Cell Lysis Solution (Qiagen) containing Proteinase K (Qiagen) ...
-
bioRxiv - Biophysics 2021Quote: ... at 20°C overnight and purified using Ni-NTA agarose (Qiagen) followed by cleavage of the His-tag with 3C protease and dephosphorylation with bovine alkaline phosphatase (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... three of which were stored at −80 °C in PowerFecal (Qiagen) 2 mL screw-cap bead tubes until ready for DNA extraction (within 1-3 months) ...
-
bioRxiv - Neuroscience 2021Quote: ... pH 7.4 and stored at −20 °C in RNAlater solution (Qiagen). RNA was extracted using RNeasy Lipid Tissue Mini Kit (Qiagen) ...
-
bioRxiv - Biophysics 2020Quote: ... or DNAse (200 Units well−1, 1 hr, 37°C, Qiagen). DAPI was stained at 0.5 μM (5 mins ...
-
bioRxiv - Microbiology 2022Quote: ... at −80 °C using the RNeasy plus Mini Kit (Qiagen, 74134) according to the manufacturers protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... or Ni-NTA agarose column (Qiagen, for 6XHis-EIN2-C purification) according to manufacturer’s menu followed by sonication ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... coli C mutants was extracted using DNeasy Blood & Tissue kit (Qiagen). Quality of extracted DNA was confirmed before sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... Plant samples were homogenized at -80 °C in a TissueLyser (Qiagen) and resupendend in a 10-fold excess of 80% (w/v ...
-
bioRxiv - Developmental Biology 2019Quote: RNA was extracted from pools of 6 × 105 FACS-isolated cells using the miRNeasy Micro Kit (Qiagen). Quantification of total RNA was performed by Qubit® RNA BR Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were transfected in 10 cm2 or 6-well plates at ∼60% confluency using PolyFect (Qiagen 301107) and washed with complete media 6 h later.
-
bioRxiv - Plant Biology 2020Quote: ... Total RNA (at least 6 μg) was extracted using the RNeasy Plant Mini kit (Qiagen, Hilden, Germany), with an additional step to remove contaminating DNA ...
-
bioRxiv - Plant Biology 2020Quote: ... 6 and 48 HAT to ammonium or nitrate amended plates using RNeasy® Plant Mini kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2022Quote: ... RNA was isolated from 5-6 replicated lung slices from each treatment using miRNeasy Mini Kit (Qiagen) at time 0 and time 120 hours for all groups ...
-
bioRxiv - Molecular Biology 2020Quote: SH-SY5Y cells plated in 6-well plates were lysed using 750ul of QIAzol Lysis reagent (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... GAS and SOL muscles from 6 mice per group were pulverized and lysed in RLT buffer (Qiagen) and treated with proteinase K (Qiagen ...
-
bioRxiv - Microbiology 2019Quote: ... qPCR cycles were run as described elsewhere 6 but using a Rotor Gene-Q instrument (QIAGEN, GER). To quantify the relative abundance of Cori and ter chromosomal regions in each sample ...
-
bioRxiv - Immunology 2022Quote: BMDMs were grown in 6-well plates and RNA was isolated using the RNeasy Mini kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: Total RNA from cardiomyocytes was obtained on day 6 post adenovirus infection using the RNeasy kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: RNA was extracted from cortical neurons on 6 cm dishes using RNeasy Plus Mini Kit (QIAGEN, 74134) and reverse-transcribed using SuperScript II (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: Amplification was carried out in a Rotor Gene thermocycler 6-plex with Quantitect Multiplex PCR kit (Qiagen) with 0,24μM of each primer y 0,25μM of each probe under the following conditions ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from 4-6 dpf zebrafish larvae using the RNeasy Plus Micro Kit (Qiagen). cDNA was synthesized using the SuperScript III First-Strand Synthesis System (Invitrogen) ...
-
bioRxiv - Bioengineering 2023Quote: ... gDNA was purified from cells in 6-well plates using the DNeasy blood and tissue kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: Fibroblasts were grown to confluency in 6-well plates and total RNA extracted using RNeasy Kit (Qiagen). Poly(A)-tailed RNA enrichment and library construction was performed using KAPA stranded mRNA-Seq Kit with KAPA mRNA capture beads (KAPABiosystems) ...
-
bioRxiv - Plant Biology 2020Quote: ... at 65°C overnight and treated with 2 μg RNase A (Qiagen) for 1h at 37°C ...
-
bioRxiv - Biophysics 2019Quote: ... overnight at 37 °C and purified by a PCR purification kit (Qiagen). Subsequently ...
-
bioRxiv - Neuroscience 2020Quote: ... at −80°C until RNA extraction using the RNeasy Mini Kit (Qiagen). RNA quality was determined using the RNA nano assay on a 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA samples were stored at -20°C in AE buffer from Qiagen DNeasy Plant Mini Kit.
-
bioRxiv - Biochemistry 2020Quote: ... Crystallization screening was performed at 4°C with JCSG core I (Qiagen) using the sitting drop vapor diffusion method ...
-
bioRxiv - Microbiology 2020Quote: ... for 3 hours at 37°C and purified using RNAeasy columns (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Neuroscience 2023Quote: ... at a frequency of 28/s @ 4°C (Tissue Lyser II, Qiagen). After this step the samples were adjusted to RT for 5 minutes and processed using the RNeasy Lipid Tissue Mini Kit (Qiagen ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pH 7.5 at 4°C) and purified using the RNAeasy kit (Qiagen).
-
bioRxiv - Microbiology 2021Quote: Confluent 6-well plates of BAC16-iSLK.RTA cells were lysed using a DNeasy Blood and Tissue Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNAs were isolated from 6-month H19ΔICR/H19ΔICR and H19+/H19+ littermates (2 per genotype) using RNeasy Plus Mini Kit (Qiagen). Samples with RNA Integrity numbers >9 were Ribosomal RNA depleted using RiboZero Gold Kit (Illumina) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Paired-end reads were mapped to the transcriptome (above) using default settings on CLC Genomics Workbench 6 (Qiagen) except that read alignments were done with a relaxed length fraction of 0.5 ...
-
bioRxiv - Genomics 2020Quote: ... We extracted genomic DNA from the above 6 stocks individually by using DNeasy blood and tissue kit (Qiagen), and measured the purity and concentration of the resulting DNA with NanoDrop ND-1000 spectrophotometer (Thermofisher) ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA was collected from a single 6 cm dish using the DNEasy Blood & Tissue kit (69504, Qiagen). For both reps of day 0 ...
-
bioRxiv - Systems Biology 2020Quote: Three milliliters of cells from mid-log phase cultures were mixed with 6 mL RNAprotect Bacteria Reagent (Qiagen). Samples were mixed immediately by vortexing for 5 s ...
-
bioRxiv - Neuroscience 2021Quote: ... We pooled 2-3 fishes (6 weeks old) and extracted whole RNA using the RNAEasy Micro kit (Qiagen), with blood ...
-
bioRxiv - Microbiology 2020Quote: ... The 6 × his-tagged proteins were purified using a nickel-nitrilotriacetic acid (Ni-NTA) agarose matrix (30250, Qiagen). Cell-free extracts were loaded on 0.5 ml Ni-NTA matrixes and incubated on a roller shaker for 2 h at 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... IL-6 and β-actin cDNA were determined by QuantiFast SYBR Green PCR Master Mix (Qiagen, Hilden, Germany) at the conditions ...