Labshake search
Citations for Qiagen :
101 - 150 of 3060 citations for 6 1 4 Dioxa 8 azaspiro 4.5 dec 8 yl 3 pyridinyl boronic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... and human BON1 cell line [8] were isolated with RNeasy Plus Universal Kits (Qiagen Cat no. 73404, Germantown, MD) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... The solubilized membranes were centrifuged in a Sorvall WX ultracentrifuge (~109,000 g; 45 min, F50L-8×39 rotor) and the supernatant was incubated with Ni-NTA resin (Qiagen) for 2 hours ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and 8 were transfected with a pool of cytotoxic siRNAs (“AllStars” wells, positive control, Allstars maximal death control, Qiagen). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... The pure genomic DNA was sheared by ultrasound and 2-8 kb fragments were extracted from a 0.7% agarose gel using the Gel Extraction Kit (Qiagen). The gel-recovered fragments were ligated to the linearized PZE12 vector (prime 3,4 ...
-
bioRxiv - Systems Biology 2020Quote: ... 3 mL of culture were mixed with 6 mL of RNAprotect bacteria reagent (Qiagen) and processed according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 5.6 x 105 cells were seeded in 4 ml DMEM in a 6-cm culture plate and transfected with targeting or control siRNA (Table 4) (from Qiagen) to a final concentration of 20 nM for each siRNA used ...
-
bioRxiv - Genomics 2019Quote: ... cfDNA was extracted from 1 or 4 ml of urine according to manufacturer recommendations (Qiagen Circulating Nucleic Acid Kit, Qiagen, Valencia, CA) and quantified using a Qubit fluorometer 3.0 (high sensitivity double-stranded DNA kit ...
-
bioRxiv - Biochemistry 2020Quote: ... at 4°C and the supernatant was loaded onto a 1 ml nickel nitrilotriacetic acid-agarose column (Ni-NTA, Qiagen, Hilden, Germany) previously equilibrated with the corresponding lysis buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... The supernatant was incubated at 4 °C overnight with Ni2+-nitrilotriacetic acid resin (Qiagen) pre-equilibrated with buffer B ...
-
bioRxiv - Genetics 2021Quote: Relative telomere length of MDS patients was measured by quantitative polymerase chain reaction (qPCR) as previously reported.8 K562 cell DNA was extracted using the QIAamp Blood Mini kit (Qiagen). Telomere length was measured by two orthogonal methods ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... pH 5.8) under long day condtions (16h light) at 24 °C (day) 22 °C (night) using the DNeasy Plant Kit (Qiagen). ONSEN copy numbers were determined by qPCR using 12 ng total DNA using the KAPA SYBR FAST master mix universal on a C1000 Touch (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... after adding 1.0 x 10^8 copies/μL of cel-miR-39 exogenous spike-in control (Qiagen 219610 Lot#157036035), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: All RNA was extracted from pellets of cultured cells (passage numbers ranging from 8-14) and cryosections of snap frozen tumor material with the RNeasy Plus Mini Kit (Qiagen).
-
bioRxiv - Genetics 2021Quote: ... The gDNA pellet was dissolved in 1mL TE pH 8 buffer and incubated with RNase A with a concentration of 100ug/mL (Qiagen) for 1 hour at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: Total RNAs were extracted from 20 heads (or 15 thoraces or 15 abdomens) of 8-day-old flies using the QIAzol Lysis reagent (Qiagen). The Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: Total RNA was isolated from HLMEC after 8 h of NP exposure with the RNeasy Mini Kit (Qiagen, Germantown, MD) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: Genomic DNA was prepared from cryosectioned material by dissolving 8-μm sections in Buffer AL and purifying with the DNeasy Blood & Tissue kit (Qiagen). Whole-exome sequencing at 100x coverage was performed as a contract service with Genewiz ...
-
bioRxiv - Neuroscience 2021Quote: A total of 8 frozen brain samples (five controls and three infected with ZIKV) were processed in TissueLyser® (Qiagen) for 30 seconds at 30Hz for cell disruption ...
-
The mitochondrial genome of the red icefish (Channichthys rugosus) casts doubt on its species statusbioRxiv - Zoology 2022Quote: A small piece of muscle tissue (5.8 mg dry weight) was dried in a vacuum centrifuge and immersed in lysis buffer (260 μL ATL buffer (Qiagen) and 40 μL Proteinase K [20 mg/mL]) ...
-
bioRxiv - Microbiology 2022Quote: For RNAseq the pellets were resuspended in 150 µL 10 mM Tris-HCl pH 8 and mixed with 700 µL of ice cold RLT+BME (RLT buffer (Qiagen) supplemented with 1% β-mercaptoethanol ...
-
bioRxiv - Biochemistry 2020Quote: ... resuspended in buffer A supplemented with 8 M guanidine hydrochloride (= buffer B) and loaded onto an Ni-NTA agarose column (QIAGEN) pre-equilibrated in the same buffer ...
-
bioRxiv - Microbiology 2019Quote: A549 or DF-1 cells in 6-well plates were infected with the specified IAVs and total RNA was extracted 8 hpi using a RNeasy Kit (Qiagen). Total RNA was eluted in RNase-free water and stored at −80 °C until needed.
-
Revisiting a GWAS peak in Arabidopsis thaliana reveals possible confounding by genetic heterogeneitybioRxiv - Genetics 2021Quote: ... total RNA was extracted from aerial parts of nine-leaf stage seedlings collected at 8 h after dawn using RNeasy mini kit (Qiagen) with DNase treatment (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2020Quote: ... 25 nuclei were sorted into each well of 96-well plates (8-10 plates per experiment) containing 12 µl of nuclear lysis buffer (11 µl of EB buffer (Qiagen) supplemented with 0.5 µl of 100X BSA and 0.5 µl of 1% SDS) ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA for PIWIL3 5′ RACE was extracted from the ovaries of 8-week-old golden hamsters using ISOGEN (Nippon Gene) and RNeasy (Qiagen). 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio ...
-
bioRxiv - Cell Biology 2020Quote: The validated Alx1DN (N-terminal portion of protein product containing homeodomain and nuclear localization domains) clones in pCS2+8 were purified via miniprep (Qiagen) alongside a control (C-terminal portion containing transactivation domain) ...
-
bioRxiv - Genetics 2019Quote: ... in each well of 8-stripped PCR tubes by shaking with a zirconia bead (2 mm in diameter, Nikkato, Japan) in TissuLyser II (Qiagen) for 30 s at 30 Hz ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was harvested following an 8 hour DMSO or 10 nM E2 induction with buffer RLT plus (Qiagen, 1053393) supplemented with 1% beta-mercaptoethanol (Sigma Aldrich ...
-
bioRxiv - Genetics 2022Quote: ... 8 cm of leaf tissue was harvested on ice and then lyophilized using a TissueLyser II (Qiagen, Valencia, CA, USA). Genomic DNA was extracted using a Qiagen DNeasy Plant Mini Kit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: RNA from frozen FC area 8 was extracted following the supplier’s instructions (RNeasy Mini Kit, Qiagen® GmbH, Hilden, Germany). RNA integrity and 28S/18S ratios were determined with the Agilent Bioanalyzer (Agilent Technologies Inc ...
-
bioRxiv - Microbiology 2023Quote: ... pH was adjusted to 8 after resuspension to allow the binding of 6x His-tagged toxins to Ni-NTA agarose resin (reference: 30210; Qiagen). Resulting samples were passed through chromatography columns containing the Ni-NTA agarose resin and were eluted with denaturing buffer containing increasing concentrations of Imidazole (10 mM ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA was isolated from Arabidopsis seedlings (8 seedlings per sample) using the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) 24 h after the elicitor treatment ...
-
bioRxiv - Microbiology 2023Quote: ... and RNAI were amplified by PCR (primer sequences are listed Supplementary Table 8) and PCR products were analysed by 2 % agarose gel electrophoresis and purified using the QIAquick PCR purification kit (QIAGEN). 5’-triphosphate (PPP ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was generated as previously described.8 The cDNA and purified viral DNA were used for quantitative PCR (qPCR) using QuantiTect probe PCR master mix (Qiagen) and optimized concentrations of forward primer (TGTGTGGGAGACCATCAAGC) ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was isolated from flash frozen 8 μm thick sections of tibialis anterior muscles embedded in OCT using the RNeasy Mini Kit (Qiagen) and evaluated using the RNA high sensitivity kit (Agilent RNA 6000 Pico Kit ...
-
bioRxiv - Genomics 2023Quote: ... After ligation nuclei were pelleted and resuspended in cold PBS with DAPI to a final concentration of 300nM and GFP+ cells were FAC-sorted into a 96 well plate with 2ul lysis buffer (20mM Tris pH 8, 20mM NaCl, 0.15% Triton X-100, 25mM DTT, 1mM EDTA, 500nM Carrier ssDNA, and 15ug/mL Qiagen Protease) and lysed for 1 hour at 50°C and inactivated 15 minutes at 70°C ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 75 ng of rRNA was reverse transcribed and amplified with 8 PCR cycles using the OneStep RT-PCR kit (Qiagen) and primers MS2_quant_F and MS2_quant_R (Supplemental Table 5) ...
-
bioRxiv - Microbiology 2023Quote: ... an unbiased amplification method was employed by amplifying the purified DNA at 30°C for 8 hours using a REPLI-g Single Cell kit (Qiagen). The amplified DNA was purified using AMPure XP magnetic beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2024Quote: ... samples were resuspended in 100 μl TE buffer pH 8 and RNA extraction performed according to the RNeasy Mini Kit (Qiagen) protocol with few modifications ...
-
bioRxiv - Biochemistry 2023Quote: ... SUMO protease was added at a final concentration 1/10 and the mixture was dialyzed overnight at 4 °C against the buffer DB6 (50 mM Tris-HCl pH 8, 150 mM NaCl, 10 mM imidazole) and applied on a NiNTA column (Qiagen) equilibrated in the DB6 buffer ...
-
bioRxiv - Microbiology 2020Quote: ... vIL-6 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using QuantiTect Multiplex RT-PCR Kits (Qiagen) as described previously (37 ...
-
bioRxiv - Microbiology 2020Quote: ... The 6 × his-tagged proteins were purified using a nickel-nitrilotriacetic acid (Ni-NTA) agarose matrix (30250, Qiagen). Cell-free extracts were loaded on 0.5 ml Ni-NTA matrixes and incubated on a roller shaker for 2 h at 4 °C ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Biochemistry 2024Quote: ... The remaining supernatant was centrifuged again at 5,000 x g for 20 minutes at 4°C and equilibrated for 1 hour in 3 mL of Ni-NTA resin (Qiagen) that was pre-equilibrated in the extraction buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA was extracted and 5 μg reverse transcribed from paired isolated Jz and Lz placental tissues (n = 8-10 per genotype/sex, across 11 litters) using the RNeasy Plus Mini Kit (Qiagen, DE) and the High-Capacity cDNA Reverse Transcription Kit minus RT inhibitor (Applied Biosystems ...
-
bioRxiv - Genetics 2021Quote: DNA was isolated from each of the 8 samples of flies using an adaptation of the Gentra Puregene Cell Kit protocol (Qiagen, 158767). Briefly ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNA was extracted from 32D-Cas9 cell lines expressing sgRNAs targeting Cbl introns 7 and 8 using an RNeasy Mini Kit (QIAGEN, 74106). cDNA was prepared using a QuantiTect Reverse Transcription Kit (QIAGEN ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... We extracted RNA from a total of 348 individuals across two early developmental stages (2 days post fertilization (dpf) and 8 dpf) using RNeasy Mini Kits (Qiagen, Inc.). For 2 dpf libraries ...
-
bioRxiv - Neuroscience 2020Quote: DNA and RNA from 8-10 mice was isolated and purified with AllPrep-DNA/RNA/miRNA-universal kit (Qiagen, Montreal, QC) and concentrations were determined by fluorometry on the Qubit system (Invitrogen ...