Labshake search
Citations for Qiagen :
101 - 150 of 2849 citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2024Quote: ... The obtained 5□- and 3□-RACE products were purified using a QIAquick Gel Extraction Kit (QIAGEN), subcloned into a pTAC-2 Vector (Bio Dynamics Laboratory lnc. ...
-
bioRxiv - Microbiology 2024Quote: ... and homogenized by bead-beating with 3 x 5 mm stainless steel beads (Qiagen, Hilden, Germany) in 1 ml sterile 1X PBS to produce internal fly-bacterial suspensions.
-
bioRxiv - Microbiology 2024Quote: 3-5 × 105 cells were harvested and total RNA was extracted using the RNeasy kit (Qiagen) employing on-column DNase treatment ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tagmented DNA was purified using the Minelute Cleanup Kit (Qiagen, Hilden, DE, Cat #28004). DNA was amplified with 12 cycles of PCR using the NebNext Hi-Fi 2X PCR Master Mix (New England Biolabs Inc ...
-
bioRxiv - Molecular Biology 2020Quote: ... the samples were de-crosslinked and purified using a QIAquick PCR purification kit (Qiagen) and analysed using a qPCR.
-
bioRxiv - Microbiology 2022Quote: ... Reads were processed and de novo assembled using the CLC Genomics Workbench software (Qiagen). Assembled genomes were annotated using the RAST annotation pipeline and GeneMarkS (63 ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was generated using the QuantiTect reverse transcription kit with gDNA Wipeout (Qiagen, DE). Conventional PCR amplification of Gpr116 was achieved using the forward primer 5’ TCCAATTCGAGGGACCGAAG 3’ and reverse primer 5’ GTAGTTCACAACCACGCTGC 3’ ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Multipex PCR Kits used for MASC PCR were purchased from QIAGEN (Hilden, NRW, DE). Plasmids were extracted using Omega E.Z.N.A DNA Isolation Kit (Omega Bio-Tek ...
-
bioRxiv - Neuroscience 2021Quote: ... and the RNA was isolated using a RNeasy Plus Micro Kit (Qiagen, Düsseldorf, DE) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was extracted by the RNeasy Mini kit from QIAGEN (74104, Hilden, DE). The library preparation and sequencing were performed by Eurofins Genomics (Tokyo ...
-
bioRxiv - Cancer Biology 2024Quote: ... while RNA was extracted from intestinal organoids using the RNeasy Mini Kit (Qiagen, DE). For cDNA synthesis ...
-
bioRxiv - Cancer Biology 2024Quote: ... De-crosslinked DNA and input was purified using a PCR purification kit (QIAGEN, 28106). The immunoprecipitated samples along with input were analyzed by q-RT PCR using KAPA SYBR® FAST (Sigma ...
-
bioRxiv - Genomics 2020Quote: ... for 1h at 37C and purified from a 2% agarose gel (QIAquick Gel Extraction Kit, Qiagen). In parallel ...
-
bioRxiv - Neuroscience 2021Quote: ... matching a sequence in intron 22 of the HTT gene (5’-TAATACGTAAGTGTCACAA-3’, custom synthesized by Qiagen) was delivered by intracerebroventricular (ICV ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA was extracted from pools of 3-5 second leaves using the Plant RNAeasy kit (Qiagen) using manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... cells pooled from n = 3 - 5 mice / cohort) was isolated using the RNeasy Plus Mini Kit (Qiagen). Clariom S microarray analysis (Affymetrix ...
-
bioRxiv - Bioengineering 2024Quote: ... Tsg101 (Hs_TSG101_6) target sequence: 5′-CAG TTT ATC ATT CAA GTG TAA -3′ (QIAGEN, cat. no. SI02655184); Alix (Hs_PDCD6IP_5 ...
-
bioRxiv - Bioengineering 2024Quote: ... Alix (Hs_PDCD6IP_5) target sequence: 5′-AAG AGC TGT GTG TTG TTC AAT -3′ (QIAGEN, cat. no. SI02655345); Negative Control siRNA ...
-
bioRxiv - Physiology 2022Quote: RNA was isolated from cells and mouse kidney using the RNeasy Mini Kit (Qiagen, DE). cDNA was generated using the QuantiTect reverse transcription kit with gDNA Wipeout (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA from cell cultures was isolated using the RNeasy Mini Kit from Qiagen (Düsseldorf, DE). RNAs quality and concentration were determined using a NanoDrop ND-1000 Spectrophotometer ...
-
bioRxiv - Microbiology 2024Quote: ... and a de novo assembly was performed using CLC genomics workbench 20.0.4 (QIAGEN, Hilden, Germany). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... and a de novo assembly was performed with CLC genomics workbench 20.0.4 (QIAGEN, Hilden, Germany). Finally ...
-
bioRxiv - Biophysics 2024Quote: ... the DNA was concentrated and purified using the Gel Extraction Kit from Qiagen (Hilden, DE). Lastly ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from pellets using the Qiagen DNeasy UltraClean Microbial Kit (Qiagen, Hilden DE) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Data were de novo assembled using the CLC Genomics Workbench v.11 (Qiagen, Milan, Italy) and edited with MEGA X (11 ...
-
bioRxiv - Physiology 2024Quote: RNA was extracted using RNeasy mini-kit following the manufacturer’s instructions (74104; Qiagen, Hilden, DE). Liver gene expression profiles were assessed via bulk RNA-sequencing as previously described [29] ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Neuroscience 2023Quote: ... LNA-CTG and the control scrambled LNA-modified sequence (LNA-SCB) 5′-GTGTAACACGTCTATACGCCCA-3′ were obtained from Qiagen as previously described in Rue et al 34
-
bioRxiv - Cancer Biology 2024Quote: ... total RNA was extracted from 3 – 5 x 106 cells using Rneasy kit with Dnase I treatment (QIAGEN), following manufacture instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The DNA of the 20 Jan and 3 Mar 2021 samples (1/3 pellet) was extracted with the DNeasy UltraClean Microbial Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: Purification of the de-crosslinked chromatin was performed using the QIAquick PCR Purification Kit from Qiagen. The concentration was determined using the Qubit fluorometer and Quanti-iT™ PicroGreen® dsDNA Kit according to manufacturer instructions.
-
bioRxiv - Genomics 2020Quote: ... De novo genome assembly was performed using CLC Genomics Workbench 11 (QIAGEN Bioinformatics, Redwood City, CA). Depth of coverage ranges between 17X-608X (Supplemental Table S4) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and DNA extraction was carried out using the DNeasy Blood & Tissue kit (Qiagen, Hilden, Germany, DE).
-
bioRxiv - Plant Biology 2022Quote: ... The RNA reverse-transcription was carried out using a QuantiTectReverse Transcription Kit (Qiagen N.V., Hilden, DE) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... The networks and functional analyses of DE genes were generated with Ingenuity Pathway Analyser (IPA; QIAGEN Inc. ...
-
bioRxiv - Genomics 2022Quote: ... DE cells were treated with 500 nM LNA miR-182 inhibitor (Qiagen, Hilden, Germany; #4101243-101) or scrambled control (Power Negative Control A ...
-
bioRxiv - Plant Biology 2022Quote: ... The supernatant was applied to a 2-ml column of Ni-NTA-agarose (Qiagen, Hilden, DE) at a flow rate of 1 ml min−1 ...
-
bioRxiv - Genomics 2022Quote: Contigs from a de novo genomic assembly in CLC Genomics Workbench (v9; Qiagen, Redwood City, CA) were identified as mitochondrial due to sequence similarity with P ...
-
bioRxiv - Developmental Biology 2023Quote: ... Purification of the de-crosslinked chromatin was performed using the QIAquick PCR Purification Kit from Qiagen. The concentration was determined using the Qubit fluorometer and Quanti-iT™ PicroGreen® dsDNA Kit according to manufacturer instructions.
-
bioRxiv - Immunology 2023Quote: DE genes between clusters 2 and 4 were fed to Ingenuity Pathway Analysis software from Qiagen. Enrichment pathways were sourced from Ingenuity core enrichment pathways.
-
bioRxiv - Microbiology 2023Quote: ... RNAs from the eluted fraction were extracted using de miRCURY RNA Isolation Kit Cell & Plant (QIAGEN) and stored at -80 °C until cDNA library preparation ...
-
bioRxiv - Genomics 2023Quote: ... which were merged into one assembly using CLC-Bio Genomics Workbench De Novo Assembly (Qiagen, v11.0.1) with default parameters ...
-
bioRxiv - Microbiology 2024Quote: ... Contigs were obtained by combining de novo assembly and mapping (both with CLC Assembly Cell, Qiagen) using a dedicated workflow implemented on the Galaxy platform of Institut Pasteur (Mareuil ...
-
bioRxiv - Evolutionary Biology 2024Quote: We extracted RNA from skin tissue using the RNeasy Mini Kit (Cat #74104, Qiagen, Hilden, DE) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... 5 µL Proteinase-K (20 mg ml-1, Qiagen) was added to the solution and incubated at 60°C for 30 minutes ...
-
bioRxiv - Genomics 2021Quote: ... then 24 mL buffer PB (5:1, Qiagen #19066) and 1.2mL NaOAc were added sequentially ...
-
bioRxiv - Microbiology 2022Quote: ... 100ng of RNA was converted to cDNA for 1h at 37 °C using the Omniscript RT kit (Qiagen) and random primers (Promega) ...