Labshake search
Citations for Qiagen :
101 - 150 of 3077 citations for 5 5 7 7 Tetramethyl 1 5 6 7 tetrahydrocyclopenta f indazol 4 amine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Total RNA from h-iECs which have been expanded for 7 days was extracted using Rneasy Mini Kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: RNA was extracted from ME49 Δhxgprt::Fluc tachyzoites and bradyzoites induced for 7 days at pH 8.2 using RNeasy Mini Kit (Qiagen) combined with QIAshredder (Qiagen ...
-
bioRxiv - Genomics 2021Quote: ... A neighbour-joining tree was built using the Jukes-Cantor nucleotide distance model and 1,000 bootstraps in CLC Sequence Viewer 7 (Qiagen).
-
bioRxiv - Microbiology 2020Quote: DNA for metagenomic sequencing was extracted from ~7 g sediment (~0.7 g sediment in 10 individual lysis tubes) using PowerSoil DNA Isolation Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... the samples were run in the ViiA 7 Real-Time PCR System with the QuantiTect SYBR Green (Qiagen, 204143) (2017) ...
-
bioRxiv - Genomics 2023Quote: Genomic DNA was harvested from post-transfection HuH-7 cells using the DNeasy Blood & Tissue Kit (Qiagen, catalog #69506). Similarly ...
-
bioRxiv - Immunology 2023Quote: M1 and M2 macrophages (300,000/well, 96-well plate) were transfected on Day 7 with MALAT1 or control GapmeRs (Qiagen). MALAT1- or control GapmeR-transfected M1 and M2 Mφ were incubated with Texas Red-conjugated Ova and DQ-conjugated Ova (both 1 mg/ml ...
-
bioRxiv - Immunology 2024Quote: ... GC B cells (Live/Dead-CD19+IgD-CD95+GL-7+) and naïve B cells (Live/Dead-CD19+IgD+) were flow sorted into RLT Plus buffer (Qiagen) following pre-enrichment with the Pan B Cell Isolation Kit II (Miltenyi) ...
-
bioRxiv - Microbiology 2021Quote: ... NG1 (5’ACCGACCACAGGGGG-3’) and NG2 (5’-GGTTGTAAACCTCTTTCGA-3’) and HotStarTaq® Master Mix Kit (Qiagen) up to a final volume of 25 μL ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... si-FAU (5’-CCGGCGCUUUGUCAACGUUGU-3’, Qiagen), si-uS19 (5’-UCACCUACAAGCCCGUAAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-eS4X (5’-CUGGAGGUGCUAACCUAGGAA-3’, Qiagen), si-FAU (5’-CCGGCGCUUUGUCAACGUUGU-3’ ...
-
bioRxiv - Genomics 2021Quote: ... containing 5 µl RLT plus (Qiagen) with 1% v/v β-mercaptoethanol (Biorad) ...
-
bioRxiv - Developmental Biology 2023Quote: ... with one 5 mm (Qiagen, 69989) and three 2.8 mm metal beads (Precellys ...
-
bioRxiv - Cell Biology 2023Quote: ... #3: 5’-AAGCATCGATAGGTAAGTTGA-3’ (SI03130008, Qiagen); #4 ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 µL RNase free water (Qiagen), 1 µL cDNA ...
-
bioRxiv - Systems Biology 2022Quote: ... RNA was isolated from 5-6 replicated lung slices from each treatment using miRNeasy Mini Kit (Qiagen) at time 0 and time 120 hours for all groups ...
-
bioRxiv - Bioengineering 2022Quote: ... 350 µL of NucleoSpin RNA extraction buffer along with 4-5 ceramic beads (Qiagen 13113) were added 14into the tube ...
-
bioRxiv - Plant Biology 2024Quote: ... 4-5 leaf pieces from clip-inoculated samples) using RNeasy Plant Mini Kit (Qiagen, Germany). Depending on the RNA concentration ...
-
bioRxiv - Microbiology 2023Quote: ... incubated at 65°C for 5 min and beaten for 5 min in a bead beater (Qiagen) set at high speed ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria are harvested by centrifugation (5 minutes, 4°C) and washed with 1 ml cold PBS containing RNA stabilization reagents (RNAprotect, Qiagen) before flash freezing and storage at -80°C ...
-
bioRxiv - Cancer Biology 2021Quote: We performed siRNA mediated KD of endogenous FOXA1 from MCF-7 cells stably expressing either pEF1neo-V5 or pEF1neo-FOXA1-V5 using custom synthesized siFOXA1 from Qiagen. The siRNA sequences that target the 3’-UTR of FOXA1 were described in [99] ...
-
bioRxiv - Immunology 2020Quote: ... and DNA from 7-10 clones from before and after FLPo-mediated recombination was prepared by miniprep (Qiagen, cat. 27106) and sequenced by Sanger sequencing with the primer GFP int F Age 66 ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA from plants grown for 7 days after germination in rhizoboxes was extracted with the RNeasy Plant Mini Kit (Qiagen) and first strand cDNA was synthesised with the RevertAid First Strand cDNA synthesis Kit (ThermoFisher) ...
-
bioRxiv - Microbiology 2021Quote: ... Quality control and de novo assembly of the reads were done using default parameters in CLC Genomics workbench 7 (Qiagen). Whole-genome alignment was performed using Mugsy v1.2.3 (55 ...
-
bioRxiv - Genetics 2021Quote: Total mRNA was isolated from 2 dpf or 7 dpf zebrafish homogenates using the RNeasy Mini Kit (Qiagen, Cat# 74104) and reverse-transcribed with SuperScript VILO (ThermoFisher ...
-
bioRxiv - Immunology 2021Quote: ... single MR1-tetramer-binding cells from Peruvian participant 7-3 and blood bank donors 702A and 703A were sorted into 96-well plate coated with Vapor-Lock (Qiagen) containing Iscript cDNA synthesis mixture (Bio-Rad ...
-
bioRxiv - Plant Biology 2021Quote: DNA for bisulfite sequencing was isolated from dissected endosperm at 7 days after pollination using QiaAMP DNA microkit (QIAGEN 56304). Dissected tissue was obtained for two biological replicates for each genotype and incubated overnight in a shaker at 56°C in ATL buffer with Proteinase K ...
-
bioRxiv - Cell Biology 2021Quote: ... These M-cells were resuspended in 500 μl PBS pH 7.2 and mixed with 7 μl BioMag magnetic streptavidin beads (Qiagen, 311714) for 60 min at 4°C and loaded into an acrylic column with curved grade N52 magnet ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from freshly isolated T-cells on day 7 of treatment from spleens using RNeasy Kit (Qiagen). For each group ...
-
bioRxiv - Pathology 2023Quote: ... Skeletal muscle (triceps and Tibialis anterior (TA)) and spinal cord tissue samples underwent homogenization with 7 mm stainless steel beads (#69990, Qiagen) in a Tissue Lyser LT (#85600 ...
-
bioRxiv - Neuroscience 2023Quote: RNA was isolated from mature wildtype DA neurons following 7-day treatment with GluCer using the RNeasy Micro Kit (QIAGEN) and sent for bulk RNAseq to Azenta ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total RNA from 7 of these patients was extracted from CD138+ cells using the miRNeasy Mini Kit (Qiagen GmbH, Germany) according to the manufacturer’s instruction ...
-
bioRxiv - Biophysics 2024Quote: ... where the band corresponding to the desired handle length (∼1.6 kb or 1.7 kb for LH and RH respectively) was excised and then the DNA extracted using a gel-extraction kit (Qiagen). The RNA hairpin substrate was then annealed and ligated between the LH and RH handles (see final construct configuration as in Fig ...
-
bioRxiv - Immunology 2024Quote: TET2 knockout efficiency was confirmed by isolating genomic DNA from CAR T-cells at Day 7 using the dNeasy Blood & Tissue Kit (Qiagen). PCR of genomic DNA was performed with TET2 Forward Primer 5’-TCCCTGAGTCCCAGTCCATC-3’ and Reverse Primer 5’-TCAGGAATGGCCAGGTTCTG-3’ using MyTaq Red 2X Mix (Meridian Bioscience) ...
-
bioRxiv - Plant Biology 2024Quote: ... about 20 mg of tissue from 7-day-old seedlings was ground into fine powder in liquid nitrogen with a TissueLyser system (QIAGEN). Total proteins were extracted using denaturing buffer (100 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Immunology 2024Quote: ... The resulting cell suspension was concentrated by centrifugation (7 min, 350 g) and lysed in RLT buffer(Qiagen, cat. 79216 ) 0.1-0.5 *10^6 lymphocytes /sample density ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total RNA from MCF-7 cells treated as indicated was isolated using the Qiagen RNeasy Plus Mini kit (Qiagen, 74136) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... or CD8 (53-6.7) (for PbT-II CD4 T cells) prior to incubation with BioMag goat anti-rat IgG coupled magnetic beads (Qiagen) and magnetic separation ...
-
bioRxiv - Genetics 2024Quote: ... DNA samples (70–80 oocytes and 7–10 blastocysts per sample) were subjected to bisulfite conversion through 2 µg carrier RNA (QIAGEN). Nested PCR was performed using EpiTaq HS with the primers listed in Supplementary Table 4 ...
-
bioRxiv - Bioengineering 2024Quote: ... Total RNA was extracted from cultured BM-MSC on experimental days 7 and 14 using the RNeasy kit (Qiagen, USA) and then analyzed for quality and concentration using a NanoDrop (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 0.45×106 Ly6G positive cells were seeded in 6-well plates in 1.9 mL RPMI EVs depleted complete media and treated with four let-7 inhibitors or negative control for inhibitor (NC) cocktail (Qiagen miRCURY LNA miRNA inhibitors ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Synthetic Biology 2024Quote: ... an aliquot (5 µL) was treated with 0.5 µL of 5 mg/ml RNase A (QIAGEN, Hilden, Germany) at 37 °C for 30 min ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of RLT plus buffer (QIAGEN) and 60 fg of λ-DNA were added into each isolated nucleus to lyse nucleus completely ...
-
bioRxiv - Immunology 2021Quote: ... 5 ml packed Ni-NTA resin (Qiagen) were equilibrated in lysis buffer ...