Labshake search
Citations for Qiagen :
101 - 150 of 2544 citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... Capture probes that contained locked nucleic acid (LNA) residues were purchased either from IDT with a 5′ Cy3 modification and HPLC purification or from Qiagen with a 5′ amino modification with HPLC purification ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Neuroscience 2023Quote: ... LNA-CTG and the control scrambled LNA-modified sequence (LNA-SCB) 5′-GTGTAACACGTCTATACGCCCA-3′ were obtained from Qiagen as previously described in Rue et al 34
-
bioRxiv - Cancer Biology 2024Quote: ... total RNA was extracted from 3 – 5 x 106 cells using Rneasy kit with Dnase I treatment (QIAGEN), following manufacture instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5% (v/v) glycerol was mixed with 5 mL Ni-NTA resin (Qiagen) for 1 h at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... and 5 h time points were immediately mixed with 2 x volume of RNAProtect® (Qiagen) using the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNAs used were RAPH1 siRNA #2 (Hs_RAPH1_2, SI00698642) and RAPH1 siRNA #5 (Hs_RAPH1_5, SI04300982) provided by Qiagen.
-
bioRxiv - Cancer Biology 2023Quote: Each qPCR reaction consisted of 5 μL of 2× QuantiNOVA SYBR Green PCR master mix (Qiagen), 0.5 μL of 10 μM forward and reverse primers each ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 nM siKDM4C (Qiagen, SI05163977), and 20 nM HIF1A Flexitube GeneSolution siRNA (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 nM siKDM4B (Qiagen, SI00449764), 5 nM siKDM4C (Qiagen ...
-
bioRxiv - Genetics 2021Quote: ... 5 mM Multiplex-Kit (Qiagen) and HPLC water to a total volume of 10 μL per sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 uL EB buffer (QIAGEN) was added to each well and mixed ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 μl RLT (79216, Qiagen) was added ...
-
bioRxiv - Cancer Biology 2024Quote: ... additional DNA from 1-5 mL of plasma was extracted using the QIAamp® Circulating Nucleic Acid Kit (Qiagen, catalogue # 55114). Illumina sequencing libraries were constructed using SRSLY® PicoPlus DNA NGS Library Preparation Kit (ClaretBio – Cat ...
-
bioRxiv - Systems Biology 2022Quote: ... Ten millilitres of culture were pelleted by immediate centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Bioengineering 2024Quote: Ten millilitres of culture were pelleted by centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... His6-SUMO-WASHC2C-5-SNAP was purified using lysis buffer #2 and Ni-NTA-agarose beads (Qiagen). The protein was incubated with Ni-NTA beads and washed with 50 mM imidazole ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and homogenized twice at 10 s at 2 M/s with a 5-mm steal bead (Qiagen) using a tissue homogenizer (MP Biomedicals) ...
-
bioRxiv - Genomics 2024Quote: RNA was extracted from 2-5 million flash frozen cells using the RNeasy plus mini kit (Qiagen). Libraries were prepared using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (New Englands Biolabs) ...
-
bioRxiv - Bioengineering 2024Quote: ... lysis buffer and homogenized at 1000 rpm for 2 min with 5 mm Stainless Steel Beads (Qiagen) using 1600 MiniG Tissue Homogenizer (SPEX SamplePrep) ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Genomics 2021Quote: ... containing 5 µl RLT plus (Qiagen) with 1% v/v β-mercaptoethanol (Biorad) ...
-
bioRxiv - Developmental Biology 2023Quote: ... with one 5 mm (Qiagen, 69989) and three 2.8 mm metal beads (Precellys ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 µL RNase free water (Qiagen), 1 µL cDNA ...
-
bioRxiv - Genetics 2021Quote: ... and E11 (5’-AGGAAAAAGGAAATAAATTA-3’) primers on pDH373 as a template generated a smaller fragment that was cleaned up by QIAGEN MinElute PCR Purification Kit (#28004) ...
-
bioRxiv - Developmental Biology 2021Quote: ... E18.5 RNA was extracted from cortices of 3 genotypic conditional knockouts and 4 controls using the RNeasy Micro Kit (Qiagen). RNA was reverse transcribed to cDNA using the SuperScript™ II Reverse Transcriptase Kit (Invitrogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... LRRCC1-si2 (target sequence: 5’- TTA GAT GAC CAA ATT CTA CAA - 3’) and control siRNA (AllStars Negative Control) were purchased from Qiagen. siRNAs were delivered into cells using Lipofectamine RNAiMAX diluted in OptiMEM medium (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... All samples were then passed 3-5 times through a 26G needle prior to RNA isolation using the RNAeasy mini kit from Qiagen. RNA concentrations were estimated by absorbance measurement at 260 and 280 nm ...
-
bioRxiv - Pathology 2021Quote: ... DNA was extracted from epidermal tissue (approximately 3 - 5 mm2 per lesion) using a DNAeasy blood and tissue kit (Qiagen). Regressed and CsA group mice were culled at day 133 post-infection ...
-
bioRxiv - Genetics 2021Quote: ... and 99F8 (150 ng pU6-3-99F8-gRNA (DGRC Cat# 1549) and 150 ng pBS-99F8-5’HR-attP>>Act5C::GFP<
-
bioRxiv - Developmental Biology 2022Quote: A repair template containing TagRFP-T::AID with homology at the 5’ and 3’ ends to the egl-43 locus was PCR amplified and purified using a PCR purification kit (Qiagen). 3 μl of 10 μM tracRNA (IDT ...
-
bioRxiv - Genomics 2022Quote: ... were annealed (10 μL each 100 μM) to 10 μL 5′-[Phos]-CTGTCTCTTATACACATCT-3’ oligonucleotide (100 μM) within 80 μL EB buffer (Qiagen), incubating 2 min at 95°C and cooled to room temperature (0.1°C/sec) ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was extracted from 3-5 mm ear primordia of the inbred line B73 using RNeasy Mini Kit (Qiagen) with on-column DNase I (Qiagen ...
-
bioRxiv - Genomics 2023Quote: ... Second strand synthesis was performed after thawing by the addition of 5 µL of second strand synthesis mix (3 µL of elution buffer [Qiagen] ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... CCR6int and CCR6high subsets of CD4+ T cells were used for isolating RNA without and with prior activation with 20 ng/ml PMA and 1 mM ionomycin for 3 h at 37°C under 5% CO2 using RNeasy Mini Kit (Qiagen) and gene expression levels were determined using Illumina Human WG6 Expression BeadChip Version 3 arrays (Illumina Inc. ...
-
bioRxiv - Cell Biology 2024Quote: ... SF was transfected with 12.5 nM antisense LNA GapmeRs CBP (Qiagen, Sequence: 5′-GCG GCG ATC CTT TAG A-3′) or p300 (Qiagen ...
-
bioRxiv - Developmental Biology 2024Quote: ... 200 ng psiCHECK-2 reporter plasmid were co-transfected with 5 µl miScript miRNA mimics (Qiagen; CatNo. 219600) using 4 µl Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... incubated at 65°C for 5 min and beaten for 5 min in a bead beater (Qiagen) set at high speed ...
-
bioRxiv - Microbiology 2022Quote: ... and the amplified DNA bands from the 5’ and 3’ ends were individually excised and purified with QIAquick® Gel Extraction Kit (QIAGEN). Purified PCR products were cloned into pJET1.2/blunt plasmid (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... Cells were maintained at 37°C in 5% CO2 for 3 days before collecting genomic DNA using DNeasy Blood & Tissue Kits (Qiagen, 69504) and sequencing.
-
bioRxiv - Cell Biology 2024Quote: Hand SFs were transfected with 50 nM antisense LNA targeting HOXD10 (Qiagen, Sequence: 5′-TGT CTG CGC TAG GTG G-3′), HOXD11 (Qiagen ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... an aliquot (5 µL) was treated with 0.5 µL of 5 mg/ml RNase A (QIAGEN, Hilden, Germany) at 37 °C for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl of cDNA was then added to a PCR mix containing 12.5 μl 2× Multiplex PCR mix (Qiagen), 9 μl H2O ...
-
bioRxiv - Genomics 2023Quote: MII oocytes and 2-cell embryos were individually lysed and flash-frozen in 5 μl RLT Plus buffer (Qiagen) and stored at −80°C until further use ...