Labshake search
Citations for Qiagen :
101 - 150 of 1796 citations for 3 Chloro 5 fluoro 4' morpholinomethyl benzophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... RNA was pooled from 3-4 wells of an MEA plate and then extracted using the miRNeasy kit (Qiagen). RNA levels were measured using the nanoString nCounter® PlexSet™ (nanoString ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant was incubated for 2h at 4°C with 5 ml of Ni-NTA agarose (Qiagen) pre-equilibrated in wash buffer 1 WB1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... a cancer associated fibroblast (CAF) cell line (pCAF2) expressing TGF-β responsive SMAD2/3/4 RE-Luciferase (Qiagen, #CLS-017L) was created ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Biochemistry 2024Quote: ... The remaining supernatant was centrifuged again at 5,000 x g for 20 minutes at 4°C and equilibrated for 1 hour in 3 mL of Ni-NTA resin (Qiagen) that was pre-equilibrated in the extraction buffer ...
-
bioRxiv - Immunology 2022Quote: ... Kidneys were mechanically disrupted with metal beads during 3 min at 4°C and DNA was then extracted using QIAmp DNA kit (Qiagen). Leptospiral DNA was specifically targeted using primers and probes designed in the lpxA gene (L ...
-
bioRxiv - Cancer Biology 2022Quote: 3 Type D and 3 Type V SCLC tumor-derived cell lines were treated with either vehicle (EtOH) or 4-OHT for 3 days and RNA was isolated using the RNeasy Mini Kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted from 5,000 sorted melanocytes from 3-4 control or ID1-overexpressing fish per stage using RNeasy Micro Kit (Qiagen, 74004). Ultralow input RNA-seq was performed using the SMART-Seq v4 Ultra Low Input RNA kit for Sequencing (Clontech ...
-
bioRxiv - Biophysics 2022Quote: ... The suspension was spun down at 16,000 r.c.f at 4 °C for 30 min and the supernatant was applied 5 ml Ni-NTA resin (Qiagen)/ L culture medium ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 °C for 1 h and purified by affinity chromatography using a 5 ml Ni-HP column (Qiagen). Flow through with pure AstaPo1 was collected and dialyzed overnight against the buffer containing 50 mM Tris pH 7.6 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Plates were then placed at 4 0C before adding the reverse transcription mix containing 5’-biotinylated TSO (Qiagen). PCR products were cleaned up using 0.8:1 Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Genetics 2021Quote: ... and E11 (5’-AGGAAAAAGGAAATAAATTA-3’) primers on pDH373 as a template generated a smaller fragment that was cleaned up by QIAGEN MinElute PCR Purification Kit (#28004) ...
-
bioRxiv - Cell Biology 2022Quote: ... LRRCC1-si2 (target sequence: 5’- TTA GAT GAC CAA ATT CTA CAA - 3’) and control siRNA (AllStars Negative Control) were purchased from Qiagen. siRNAs were delivered into cells using Lipofectamine RNAiMAX diluted in OptiMEM medium (ThermoFisher Scientific) ...
-
bioRxiv - Genomics 2020Quote: ... and template-switching oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” indicates a ribonucleic acid base and “+” indicates a locked nucleic acid base; Qiagen). cDNA was amplified using KAPA HiFi HotStart ReadyMix kit (Roche #KK2502 ...
-
bioRxiv - Microbiology 2020Quote: ... All samples were then passed 3-5 times through a 26G needle prior to RNA isolation using the RNAeasy mini kit from Qiagen. RNA concentrations were estimated by absorbance measurement at 260 and 280 nm ...
-
bioRxiv - Molecular Biology 2022Quote: Qiagen miRCURY locked nucleic acid DIG (digoxigenin)-labeled probes (sense cATM-DIG: 5’DIG-AGTGGTTAGACAGTGATGTGT-DIG 3’) (Qiagen, Hilden, Germany) were used for ISH ...
-
bioRxiv - Pathology 2021Quote: ... DNA was extracted from epidermal tissue (approximately 3 - 5 mm2 per lesion) using a DNAeasy blood and tissue kit (Qiagen). Regressed and CsA group mice were culled at day 133 post-infection ...
-
bioRxiv - Genetics 2021Quote: ... and 99F8 (150 ng pU6-3-99F8-gRNA (DGRC Cat# 1549) and 150 ng pBS-99F8-5’HR-attP>>Act5C::GFP<
-
bioRxiv - Cell Biology 2021Quote: Formalin-fixed paraffin-embedded tissues were used for in situ hybridization (ISH) employing locked nucleic acid (LNA) probes labelled with digoxigenin (DIG) at both the 5′- and 3’-ends (Qiagen). ISH was performed with probes specific for miR-132-3p (10 nM ...
-
bioRxiv - Genomics 2023Quote: ... Second strand synthesis was performed after thawing by the addition of 5 µL of second strand synthesis mix (3 µL of elution buffer [Qiagen] ...
-
bioRxiv - Genomics 2023Quote: ... 1µM Template-Switching Oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” prefixes a ribonucleic acid base and “+” prefixes a locked nucleic acid base, Qiagen) then incubated using a ThermoMixer C with the following conditions ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was extracted from 3-5 mm ear primordia of the inbred line B73 using RNeasy Mini Kit (Qiagen) with on-column DNase I (Qiagen ...
-
bioRxiv - Developmental Biology 2022Quote: A repair template containing TagRFP-T::AID with homology at the 5’ and 3’ ends to the egl-43 locus was PCR amplified and purified using a PCR purification kit (Qiagen). 3 μl of 10 μM tracRNA (IDT ...
-
bioRxiv - Genomics 2022Quote: ... were annealed (10 μL each 100 μM) to 10 μL 5′-[Phos]-CTGTCTCTTATACACATCT-3’ oligonucleotide (100 μM) within 80 μL EB buffer (Qiagen), incubating 2 min at 95°C and cooled to room temperature (0.1°C/sec) ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... CCR6int and CCR6high subsets of CD4+ T cells were used for isolating RNA without and with prior activation with 20 ng/ml PMA and 1 mM ionomycin for 3 h at 37°C under 5% CO2 using RNeasy Mini Kit (Qiagen) and gene expression levels were determined using Illumina Human WG6 Expression BeadChip Version 3 arrays (Illumina Inc. ...
-
bioRxiv - Cell Biology 2024Quote: ... SF was transfected with 12.5 nM antisense LNA GapmeRs CBP (Qiagen, Sequence: 5′-GCG GCG ATC CTT TAG A-3′) or p300 (Qiagen ...
-
bioRxiv - Physiology 2020Quote: ... RNA was isolated from maternal and fetal tissues (Table 3 and 4) using QIAamp cador pathogen mini kit (Qiagen, Valencia, CA). ZIKV RNA was quantitated by one-step quantitative real time reverse transcription PCR using QuantiTect probe RT-PCR kit (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from 150 mg of cluster roots (3 to 4 roots) using the RNeasy Plant Mini Kit (Qiagen, 74904) and treated with the DNA-free DNA Removal Kit (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was isolated from 16 placentas (3-4 placentas/fetal sex/group) using an RNAeasy kit (Qiagen, Venlo, The Netherlands). Isolated RNA was stored at −80 °C in nuclease-free water ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was isolated from NPCs and their derived astrocytes (4 lines, n=3 per cell type) using a RNeasy mini kit (Qiagen, 74104). RNA samples were prepped using TruSeq® Stranded mRNA Library kit (Illumina ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... n=4 females [hybrid cross] and n=5 females [conspecific cross]) using the AllPrep RNA/DNA Mini Kit (Qiagen), and was stored at −80°C until sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... The supernatant was 0.2 µM filtered and was incubated overnight at 4°C with 5 mL of Ni-NTA beads (Qiagen). XXX
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted from HAEC and HCAEC (from passages 4-5) using RNeasy Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... and the amplified DNA bands from the 5’ and 3’ ends were individually excised and purified with QIAquick® Gel Extraction Kit (QIAGEN). Purified PCR products were cloned into pJET1.2/blunt plasmid (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... Cells were maintained at 37°C in 5% CO2 for 3 days before collecting genomic DNA using DNeasy Blood & Tissue Kits (Qiagen, 69504) and sequencing.
-
bioRxiv - Neuroscience 2022Quote: ... or a non-targeting scrambled control (Scr; sequence: 5’-TAACACGTCTATACGCCCA-3; Qiagen, Cat No.: 339137; 0.1 nmol in 2 μL PBS), using a 2 μL Hamilton syringe at a rate of 1 μL/min ...
-
bioRxiv - Cell Biology 2024Quote: Hand SFs were transfected with 50 nM antisense LNA targeting HOXD10 (Qiagen, Sequence: 5′-TGT CTG CGC TAG GTG G-3′), HOXD11 (Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was isolated from HFC (n = 3) and LFC (n = 4) tumor samples using the RNeasy Plus Universal Mini Kit (QIAGEN, Valencia, CA) and RNA quality was confirmed using an Advanced Analytical Fragment Analyzer ...
-
Retinal affectation in Huntington’s disease mouse models concurs with a local innate immune responsebioRxiv - Neuroscience 2023Quote: ... striatal and retinal RNA from the same R6/1 mice was pooled (3-4 samples per genotype) and further processed using the clean-up protocol of the RNeasy Mini Kit (Qiagen, Hilden, Germany), which also included on-column DNase I treatment ...
-
bioRxiv - Microbiology 2022Quote: ... Nasal turbinates and lungs were collected from a subset of hamsters at 4 dpi and homogenized in 1ml or 5 ml of PBS with TissueRuptor (Qiagen), respectively ...
-
bioRxiv - Genetics 2022Quote: Total RNA was extracted from the stomach and pyloric caeca tissue samples stored at -80 °C (n = 4 for control and fly larvae, n = 5 for shrimp shell) using the RNeasy Plus Universal Kit (QIAGEN). RNA quality was assessed using a 2100 Bioanalyzer with the RNA 6000 nano kit (Agilent ...
-
bioRxiv - Genomics 2020Quote: ... and adult females (approximately 4-5 of each) were prepared for RNAseq using the RNeasy Blood and Tissue Kit (Qiagen). Individuals were placed in a 1.5 mL safelock tube along with 5-8 one mm glass beads placed in liquid nitrogen and then shaken for 30 s in a Silamat S6 shaker (Ivoclar Vivadent) ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were pelleted at 350 x g for 5 min at 4 °C and lysed in 350 μl RLT buffer of the RNeasy Mini Kit (Qiagen). RNA was isolated according to the manufacturer’s instructions ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... Lysates were cleared by centrifugation at 15000 x g for 30 min at 4 °C and incubated in Pierce 5 ml columns with Ni-NTA agarose beads (Qiagen) at 4 °C for 1 h ...
-
bioRxiv - Genomics 2020Quote: ... and 3-week-old) and leaves (4-, 5-, and 6-week-old plants) was isolated and purified using RNeasy Plant Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated for 30 min at 4 °C with 5 mL of Ni2+-beads (Qiagen Ni-NTA Superflow) equilibrated in lysis buffer ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria are harvested by centrifugation (5 minutes, 4°C) and washed with 1 ml cold PBS containing RNA stabilization reagents (RNAprotect, Qiagen) before flash freezing and storage at -80°C ...
-
bioRxiv - Immunology 2022Quote: mRNA was isolated from Boyden chamber migration assay-derived Treg pellets from 5 HD and 4 uRRMS patients using RNeasy micro kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... The pooled cells were centrifuged at 500 × g for 5 minutes at 4°C and resuspended in 100 μl of buffer EB (Qiagen).