Labshake search
Citations for Qiagen :
101 - 150 of 1593 citations for 2 Chloro N 4 chloro 2 2 chlorobenzoyl phenyl acetamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were homogenized in 300 µL Optima™ water for 2 x 2 min at 25 Hz using a TissueLyser bead mill (QIAGEN). Another 650 µL Optima™ water was added ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was isolated at 6 time points (0, 0.5, 1, 2, 4, and 8 hours) using the RNeasy Mini kit (Qiagen) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... Those included UniSpike 2 and 4 from the QIAGEN RNA Spike-In Kit (Cat. No.: 339390, QIAGEN, Hilden, Germany), which were used to monitor RNA isolation efficacy ...
-
bioRxiv - Immunology 2021Quote: ... then diluted to 2 nM using elution buffer (Qiagen) with 0.1% Tween20 (Sigma) ...
-
bioRxiv - Biophysics 2020Quote: ... 2 mM PMSF) on a Ni-NTA resin (Qiagen). Bound proteins were washed (50 mM Tris-HCl ...
-
bioRxiv - Cancer Biology 2021Quote: ... then diluted to 2 nM using elution buffer (Qiagen) containing 0.1% Tween20 (Sigma) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... or a 3:2 mixture of QG buffer (QIAGEN) and isopropanol ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen, #SI00376208) 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... the 2 proteases of proteinase K (Qiagen, Hilden, Germany) and dispaseII (Sigma-Aldrich ...
-
bioRxiv - Genomics 2022Quote: ... 2 μl of 100 mg/mL RNase A (Qiagen) was added and the tubes were incubated at 37°C for 15 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µl Qiagen CL buffer (10x; Qiagen, Hilden, Germany), 0.4 µl MgCl2 (25 mM ...
-
bioRxiv - Bioengineering 2023Quote: ... 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) are added to one volume of bacterial culture ...
-
bioRxiv - Neuroscience 2024Quote: ... [2] or QIAzol® Lysis reagent (Qiagen, #cat 79306) following vendor’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... packed with 2 mL Ni-NTA agarose resin (Qiagen) pre-equilibrated with 15 mL lysis buffer ...
-
bioRxiv - Systems Biology 2024Quote: ... and 16.7% (v:v) Proteinase K (Qiagen, 19131, 2 mL). The suspension was then incubated at 37 ℃ for 15 minutes at 500 r.p.m.
-
bioRxiv - Biophysics 2024Quote: ... A 2 mL Ni-NTA resin (Qiagen, Cat. # 30210) was equilibrated with 10 mL of 1X Base buffer and 5 mM β-mercaptoethanol for 10 min by constantly rotating ...
-
bioRxiv - Cancer Biology 2024Quote: ... and sample incubated with 2 NiNTA resin (Qiagen, USA). Protein samples were allowed to bind for 4 hr ...
-
bioRxiv - Immunology 2021Quote: ... The pellets were resuspended with OMV buffer and re-pelleted again by centrifugation at 200,000 g for 2 h at 4°C and lysed with Qiazol followed by RNA isolation with the miRNeasy kit (Qiagen) to obtain total RNA including the small RNA fraction ...
-
bioRxiv - Microbiology 2021Quote: Total RNA of 1-2 x 106 human macrophages (2-4 biological replicates/ macrophage donors per condition, see Table S17) was isolated using RNeasy extraction kit (Qiagen) including DNAse treatment according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: A total of 600 μL (three × 200 μL) of day 4 SARS-CoV-2 culture supernatant was used as input into the RNeasy Mini Kit (Qiagen) for RNA extraction with minor modifications ...
-
bioRxiv - Cell Biology 2021Quote: Total mRNA was isolated from HEK293 (2×106) and Jurkat cells (4×106) parental and MCU-KO cell lines using the RNeasy Mini Kit (Qiagen). Isolated RNA was then analyzed using a NanoDrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Lysates were clarified by centrifugation at 24,000gat 4 °C for 20 min and passed through 2 ml of Ni-NTA nickel resin (Qiagen, 30250) pre-equilibrated with wash buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified extract was supplemented with 10 mM imidazole and rotated for 2 hours at 4 °C with 1 ml of Ni-NTA beads (Qiagen). Bound protein was eluted with 10 CV of buffer L / 200 mM imidazole ...
-
bioRxiv - Molecular Biology 2021Quote: ... Lysates were clarified by centrifugation at 24,000g at 4°C for 20 min and passed through 2 mL of Ni-NTA nickel resin (Qiagen, 30250) pre-equilibrated with wash buffer (20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Biochemistry 2023Quote: ... the cell lysate was cleared by centrifugation (20L000 rpm, 30 minutes, 4 °C) and purified using Ni+2-affinity chromatography (Ni-NTA superflow cartridges, Qiagen). Typically two 5 mL columns (flow 5 mL/min ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Microbiology 2023Quote: ... Pellets were washed in 2 mL cold 10 mM NaCl + 4 mL cold RNAprotect Bacteria Reagent (Qiagen Cat. No. 76506) and repelletted at 4,255 x g ...
-
bioRxiv - Physiology 2024Quote: ... RNA was isolated from pooled vessels (4 renal arteries or 2 mesenteric arteries) using the RNeasy Micro kit (Qiagen, USA), quantified by the NanoDrop-1000 (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... was reverse transcribed at 37 °C for 2 h in a 20 μL reaction volume containing 4 U of Omniscript reverse transcriptase (Qiagen), 0.5 mM each dNTP ...
-
bioRxiv - Biochemistry 2024Quote: ... The lysate was then cleared by centrifugation at 42,000 ξ g for 50 min at 4°C before being applied to 2 mL of Ni-NTA resin (QIAGEN) in a gravity flow column ...
-
bioRxiv - Genomics 2021Quote: ... and Vero E6 cells infected with 2 patient virus isolates was converted to cDNA using reverse transcriptase from qiaseq SARS-CoV-2 primer pool (Qiagen kit, cat no. 333896). APOBEC3b (sense ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 2 min at 40 Hz using TissueLyser LT (Qiagen). 500 µl PBS-tween (0.01% ...
-
bioRxiv - Microbiology 2021Quote: ... 2 mL of nickel-charged resin (Qiagen, Ni-NTA Agarose) was added to a column (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... using the QIAstat-Dx Respiratory SARS-CoV-2 Panel (Qiagen). Viral stocks were produced infecting at a multiplicity of infection (MOI ...
-
bioRxiv - Microbiology 2022Quote: ... in a 2 mL cryovial using a tissue lyser (Qiagen) and 0.2mm ceramic beads ...
-
bioRxiv - Microbiology 2021Quote: ... or using the QIAseq SARS-CoV-2 Primer Panel (Qiagen) (for organoid supernatants) ...
-
bioRxiv - Cell Biology 2022Quote: ... with 1% 2-mercaptoethanol then passed through Qiashredder tubes (Qiagen). RNA was extracted using the RNeasy Isolation Kit (Qiagen ...
-
bioRxiv - Genomics 2021Quote: ... QIAseq SARS-CoV-2 Primer Panel (Qiagen, cat. no. 333895) and QIAseq FX DNA Library Kit were used in order to prepare amplicon libraries for viral genome sequencing ...
-
bioRxiv - Immunology 2020Quote: ... and extension by 2 × multiplex PCR master mix (QIAGEN, USA) at 72 °C for 30 s ...
-
bioRxiv - Microbiology 2022Quote: ... loaded with 1-2 ml Ni-NTA agarose resin (Qiagen) pre-equilibrated with binding buffer ...
-
bioRxiv - Genomics 2022Quote: ... and ‘Sy-2’ plants using Genomic Tip (Qiagen, Hilden, Germany), and high-molecular-weight DNA (fragment length > 40 kb ...
-
bioRxiv - Neuroscience 2022Quote: ... and IRS solution (Qiagen Cat No./ID: 26000-50-2) for a custom protocol ...
-
bioRxiv - Microbiology 2022Quote: ... for 2×2min at 30Hz in a TissueLyser II (Qiagen). After homogenization ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Pellets were thawed in 2 mL RLT lysis buffer (Qiagen) containing 10 μL mL-1 of 2-mercaptoethanol ...
-
bioRxiv - Cell Biology 2023Quote: ... coverslips were treated with 2 mg/ml RNase A (QIAGEN) for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 μL of HiPerfect transfection reagent (cat. no. 301705, Qiagen) were mixed with 100 μL NeuroBasal medium without supplements ...
-
bioRxiv - Developmental Biology 2023Quote: ... and RNU6-2 (Hs_RNU6-2_11 miScript Primer Assay, Qiagen, MS00033740) as housekeeping miRNA.
-
bioRxiv - Biochemistry 2023Quote: ... then loaded on to 2 mL Ni-NTA column (Qiagen) pre-equilibrated with 10 column volumes of 50 mM Tris pH 7.5 containing 300 mM NaCl ...
-
bioRxiv - Genomics 2023Quote: ... using a TissueLyzer II (QIAGEN, 2min, 25 Hz, 2 times). The samples were incubated at room temperature for 5min ...