Labshake search
Citations for Qiagen :
101 - 150 of 2029 citations for 1 1 Dimethylsila 11 Crown 4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... 1× QuantiNova RT Mix (Qiagen), 1× QuantiNova SYBR Green RT-PCR Master mix ...
-
bioRxiv - Microbiology 2021Quote: ... Strep 1:1000 (Qiagen, 34850).
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μM oligo-dT18 (Qiagen) and 10 μM random hexamers (Promega).
-
bioRxiv - Biochemistry 2021Quote: ... 1% SDS (Qiagen P2 buffer). Neutralize lysis buffer by adding 300 μL of 4.2 M Guanidine HCl ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 μl of DNase (Qiagen) was added ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 U Hotstar Taq (Qiagen), 1X Hotstar Taq buffer ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 μM TSO (Qiagen). The master mix was dispensed using the MANTIS liquid dispenser followed by mixing for 1 min at 1800 rpm on a plate shaker (Biosan) ...
-
bioRxiv - Microbiology 2022Quote: ... 1 ml of QIAzol (Qiagen) was added to each pellet suspension before being transferred to Lysing Matrix B tubes (MP Biomedicals) ...
-
bioRxiv - Biochemistry 2023Quote: ... 1% SDS (Qiagen P2 buffer). Neutralize lysis buffer by adding 300 μL of 4.2 M Guanidine HCl ...
-
bioRxiv - Immunology 2024Quote: ... 1 mL RLT Buffer (Qiagen) was added to the thawed lungs ...
-
bioRxiv - Microbiology 2022Quote: ... 27620, 1:2,000 dilution) (rabbit anti-Spike S1, Cell Signaling, Cat #: 99423, 1:2,000 dilution) (mouse anti-Strep, Qiagen, Cat #: 34850, 1:2,000 dilution) (rabbit anti-ORF8 ...
-
bioRxiv - Plant Biology 2021Quote: ... we mapped resistant and susceptible cultivar RNA-seq read data to sequenced H1706 tomato genome itag 3.0 by using CLC Genomics Workbench 11 (QIAGEN). Next ...
-
bioRxiv - Microbiology 2020Quote: ... protein were adjusted to around 11 mg/mL and screened for crystallization using the 384 conditions of the JCSG Core Suite (Qiagen) on our custom-designed robotic CrystalMation system (Rigaku ...
-
bioRxiv - Genomics 2020Quote: Thirty-three RNA samples were extracted from three biological replicates of each of 11 diverse tissue types of A188 with RNeasy Plant Mini Kit (Qiagen) (Supplementary Table 10) ...
-
bioRxiv - Microbiology 2021Quote: ... the mapping of plasmid sequences to find possible mutations and to compare between treatments was performed with CLC Genomic Workbench software version 11 (Qiagen). First ...
-
bioRxiv - Microbiology 2021Quote: ... mRNA-Seq FASTQ reads were mapped to the human reference genome (Homo sapiens v81; hg38) using default options on CLC Genomics Workbench 11 (Qiagen). Total gene reads (with at least 1 read count ...
-
bioRxiv - Physiology 2021Quote: ... males n=11) and Ob (females n=10, males n=10) offspring using a commercially available kit (RNeasy Plus mini Kit, Qiagen) then reverse transcribed to cDNA (High Capacity cDNA Reverse Transcription kit ...
-
bioRxiv - Genomics 2020Quote: ... 25 nuclei were sorted into each well of 96-well plates (8-10 plates per experiment) containing 12 µl of nuclear lysis buffer (11 µl of EB buffer (Qiagen) supplemented with 0.5 µl of 100X BSA and 0.5 µl of 1% SDS) ...
-
bioRxiv - Immunology 2022Quote: ... The protein complex was adjusted to 11 mg/ml and screened for crystallization using the 384 conditions of the JCSG Core Suite (Qiagen) on our robotic CrystalMation system (Rigaku ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from Day 11 populations (n=20, 5/treatment) using Qiagen DNeasy Blood and Tissue Kit (Qiagen, Germany) adapted from the manufacturer’s instructions to include a lysostaphin lysis step(50) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Predicted mutations and unassigned missing coverage/ new junction evidence were curated manually for each sequenced clone using CLC Genomics Workbench 11 (Qiagen). To generate plasmid comparisons we used the visualization tool Easyfig (v2.2.2 ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extract (1 mg) was incubated with His6-RabD2c (1 μg) and Ni-NTA Agarose (QIAGEN) for 1 h at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA of FocnCong:1-1 was isolated using CTAB and 100/G genomic tips (QIAGEN) as described in the 1000 Fungal genomes project (http://1000.fungalgenomes.org) ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated for 1 h at 55°C with 20 mg ml−1 proteinase K (Qiagen). Samples were treated for 10 min at 65 °C with 4 μl RNase A (100 mg ml−1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µl 10x Taq buffer (Qiagen), 0.08 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of non-tailed primer ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of each of microsatellite forward and reverse primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μM template-switching oligonucleotides (QIAGEN), and 1 M betaine (Sigma 61962) ...
-
bioRxiv - Cancer Biology 2021Quote: ... HIS-tag (Qiagen 34610 1:100) and HER3 (R&D Systems AF4518 1:400) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 µM template-switching oligonucleotides (QIAGEN), and 1 M betaine ...
-
bioRxiv - Cell Biology 2021Quote: βPix siRNA – #1 - AACAATCAACTGGTAGTAAGA (Qiagen S104239011), #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen) and 0.2 μM of each primer pair ...
-
bioRxiv - Neuroscience 2023Quote: ... 5ug of Ribonuclease 1 (Qiagen, 19101) was added to each sample followed by staining with 20ug propidium iodide (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 x Qiagen PCR Buffer (Qiagen), 3 U APEX Taq (Genesee Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing 1 ml InhibitEx buffer (Qiagen). Two rounds of bead incubations were applied at 3.5 m/s for 2 min ...
-
bioRxiv - Systems Biology 2024Quote: ... NTA-agarose resin (1 mL) (Qiagen) was washed twice with 3 ml of distilled water and 2 ml of 100 mM FeCl3 in 0.1% acetic acid was added ...
-
bioRxiv - Developmental Biology 2024Quote: ... SFPQ siRNA #1 (Qiagen Cat#SI05783848), and SFPQ siRNA #2 (Qiagen Cat#SI05783876 ...
-
bioRxiv - Plant Biology 2024Quote: ... mixed with 1% beta-mercaptoethanol (Qiagen) using Kimble Chase glass tissue grinders (part# KT885450-0020) ...
-
bioRxiv - Neuroscience 2022Quote: ... and samples were diluted 1:1 in 70% ethanol and purified using RNeasy columns and reagents (QIAGEN). RNA concentration was measured using a NanoDrop spectrophotometer ...
-
bioRxiv - Systems Biology 2022Quote: ... 12 μl of 1 M Tris-HCl (pH 6.5) and 1 μl RNAse A (Qiagen cat # 19101) were added to the sample and incubated for 30 min at 37 °C ...
-
bioRxiv - Cancer Biology 2021Quote: Liver tissue was homogenized in chloroform/methanol (2:1, 1 mL) using TissueLyser (Qiagen Ltd., Manchester, UK). Deionized water (400 uL ...
-
bioRxiv - Microbiology 2024Quote: ... approximately 1 × 109 CFU of bacteria were mixed at a 2:1 (vol:vol) ratio of RNAProtect (Qiagen) and incubated at room temperature for 5 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Small pieces of tissue (~1×1 mm) were minced and placed in RLT Plus buffer (QIAgen, 1053393) supplemented with 140 mM 2-mercaptoethanol ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA was extracted and 5 μg reverse transcribed from paired isolated Jz and Lz placental tissues (n = 8-10 per genotype/sex, across 11 litters) using the RNeasy Plus Mini Kit (Qiagen, DE) and the High-Capacity cDNA Reverse Transcription Kit minus RT inhibitor (Applied Biosystems ...
-
bioRxiv - Plant Biology 2021Quote: ... we mapped DNA-seq read data to sequenced H1706 tomato genome itag 3.0 to identify SNPs using CLC Genomics Workbench 11 (QIAGEN, https://www.qiagenbioinformatics.com/). Next ...
-
bioRxiv - Genomics 2021Quote: ... or museum specimens deposited at the Paris (P) herbarium (11 extractions) using the CTAB protocol (Doyle and Doyle, 1987) or the DNeasy® Plant Mini Kit (Qiagen). We quantified DNA using the QuantiFluor® dsDNA system for a QuantusTM fluorometer (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... and siNET1 #4 (Qiagen cat# SI00082040 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 mL of stabilization mix (RNAprotect Bacteria Reagent - Qiagen diluted with PBS in a 2:1 volume ratio) was applied on plates ...
-
bioRxiv - Genomics 2020Quote: ... PCR products were cleaned-up using 1:1 of SPRI beads and eluted in 30µl elution buffer (Qiagen). The resulting amplicons were assayed on the Fragment Analyzer System (Agilent) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 ml of the non-stressed culture was added to 1 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...