Labshake search
Citations for Qiagen :
1401 - 1450 of 2774 citations for Microtubule Associated Protein 1 Light Chain 3 Gamma MAP1LC3C Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... His-6X-tagged proteins (30 μg/10 μl beads) in 400 μl of PBS were incubated with Ni-NTA Magnetic Agarose Beads (QIAGEN, Hilden, Germany) at room temperature (RT ...
-
bioRxiv - Zoology 2019Quote: ... frozen and stored in liquid nitrogen for extraction of total protein and diene conjugates or placed in QIAzol Lysis Reagent (Qiagen, Hilden, Germany) and frozen in liquid nitrogen for RNA isolation ...
-
bioRxiv - Biochemistry 2021Quote: ... The labeled protein in the soluble fraction was purified using Immobilized Metal Affinity Chromatography (IMAC) using standard methods (QIagen Ni-NTA resin). The purified protein was then concentrated to 2 mL and purified by FPLC sizeexclusion chromatography using a Superdex 75 10/300 GL (GE Healthcare ...
-
bioRxiv - Cell Biology 2019Quote: ... coli as an N-terminal histidine-tagged protein isolated from cell lysate after passage through Ni-NTA agarose (Qiagen, Cat. No. 30210). Bound TTRL55P was then eluted by competition with imidazole ...
-
bioRxiv - Microbiology 2022Quote: The recombinant His-TvFACPα full-length protein was produced and purified by a standard protocol as suggested by the supplier (QIAGEN, Hilden, Germany) (48 ...
-
bioRxiv - Molecular Biology 2019Quote: ... the cell and molecular functions and canonical pathways of these proteins were identified using Ingenuity® Pathway Analysis (IPA®) (Qiagen, Germany).
-
bioRxiv - Genetics 2021Quote: ... The final constructs were transformed into BL21 (DE3) for expression and recombinant Fur/mFur proteins were purified using Ni-NTA agarose (Qiagen, California, USA). The proteins induced by the addition of 1 mM IPTG at 16°C for 12 h ...
-
bioRxiv - Immunology 2023Quote: Total DNA and mRNA were isolated from the intestine samples collected during fish necropsy with the AllPrep DNA/RNA/Protein Kit (Qiagen, Hilden, Germany), following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The remaining 80% of the cell suspension was lysed in 6M guanidine-HCl buffer and His6-tagged proteins were captured on Ni2+-NTA resin (Qiagen; cat. #30210). Pull-down eluates and inputs were separated on SDS-PAGE gels and analyzed by immunoblot ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice received either miRCURY LNA power inhibitor for mmu-miR-335-5p (Ant-335; sequence: 5’-CATTTTTCGTTATTGCTCTTG-3’; Qiagen, Cat No.: 339132; 0.1 nmol in 2 μL PBS), or a non-targeting scrambled control (Scr ...
-
bioRxiv - Immunology 2019Quote: ... The aqueous phase was collected and mixed at a 1:1 ratio with 70% ethanol (Qiagen). RNA was isolated from this mixture using the RNeasy MinElute Kit (Qiagen) ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA of FocnCong:1-1 was isolated using CTAB and 100/G genomic tips (QIAGEN) as described in the 1000 Fungal genomes project (http://1000.fungalgenomes.org) ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated for 1 h at 55°C with 20 mg ml−1 proteinase K (Qiagen). Samples were treated for 10 min at 65 °C with 4 μl RNase A (100 mg ml−1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µl 10x Taq buffer (Qiagen), 0.08 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of non-tailed primer ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of each of microsatellite forward and reverse primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μM template-switching oligonucleotides (QIAGEN), and 1 M betaine (Sigma 61962) ...
-
bioRxiv - Cancer Biology 2021Quote: ... HIS-tag (Qiagen 34610 1:100) and HER3 (R&D Systems AF4518 1:400) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 µM template-switching oligonucleotides (QIAGEN), and 1 M betaine ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and 1 μl 10X Buffer (Qiagen). PCR products were digested for 30 minutes at 37 °C ...
-
bioRxiv - Microbiology 2019Quote: ... Cignal EGR-1 reporter kit (Qiagen) was transfected in HEK293T following manufacturer protocol ...
-
bioRxiv - Cell Biology 2021Quote: βPix siRNA – #1 - AACAATCAACTGGTAGTAAGA (Qiagen S104239011), #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen) and 0.2 μM of each primer pair ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 x Qiagen PCR Buffer (Qiagen), 3 U APEX Taq (Genesee Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing 1 ml InhibitEx buffer (Qiagen). Two rounds of bead incubations were applied at 3.5 m/s for 2 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 5ug of Ribonuclease 1 (Qiagen, 19101) was added to each sample followed by staining with 20ug propidium iodide (Thermo Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... and plasma membrane proteins were purified from cultured astrocytes using a commercially available kit (Qproteome Cell Compartment Kit; Qiagen, Inc, Germantown, MD, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... The left hippocampus was homogenized on ice in the lysis buffer from the AllPrep® DNA/RNA/Protein Mini Kit (QIAGEN, Hilden, Germany). A sample from the lysate was used to quantify total DNA and RNA content using the appropriate Qubit® Fluorometer kit (Cat ...
-
bioRxiv - Cell Biology 2023Quote: ... His-tagged DmMIC10b was detected using an anti-His antibody (Qiagen N.V., Venlo, The Netherlands, 34660).
-
bioRxiv - Biophysics 2023Quote: ... the glass was additionally treated with biotinylated anti-hexahistidine monoclonal antibody (Penta-His Biotin Conjugate; Qiagen) as in Duchi et al.23 and Dulin et al.31.
-
bioRxiv - Neuroscience 2022Quote: ... and samples were diluted 1:1 in 70% ethanol and purified using RNeasy columns and reagents (QIAGEN). RNA concentration was measured using a NanoDrop spectrophotometer ...
-
bioRxiv - Systems Biology 2022Quote: ... 12 μl of 1 M Tris-HCl (pH 6.5) and 1 μl RNAse A (Qiagen cat # 19101) were added to the sample and incubated for 30 min at 37 °C ...
-
bioRxiv - Cancer Biology 2021Quote: Liver tissue was homogenized in chloroform/methanol (2:1, 1 mL) using TissueLyser (Qiagen Ltd., Manchester, UK). Deionized water (400 uL ...
-
bioRxiv - Cancer Biology 2024Quote: ... This construct was co-transfected with the pVSV-G retroviral coat protein expression vector into GP2-293 packaging cells using Effectene (Qiagen Sciences, Inc.; Germantown, MD). At 24 h and again at 48 h post-transfection ...
-
bioRxiv - Biochemistry 2022Quote: ... Anti-His Western blots were performed using Penta-His mouse monoclonal IgG1 as primary antibody (Qiagen, #34660) at 1:2000 dilution ...
-
bioRxiv - Microbiology 2019Quote: ... and Western blot analysis was performed as previously described (30) using a primary anti-his antibody (Qiagen) and a secondary Alexa Fluor 700 goat anti-mouse antibody ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids with the cloning of synthesized antibody genes were prepared using the Megaprep plasmid plus kit (Qiagen) for transient transfection ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 mL of stabilization mix (RNAprotect Bacteria Reagent - Qiagen diluted with PBS in a 2:1 volume ratio) was applied on plates ...
-
bioRxiv - Genomics 2020Quote: ... PCR products were cleaned-up using 1:1 of SPRI beads and eluted in 30µl elution buffer (Qiagen). The resulting amplicons were assayed on the Fragment Analyzer System (Agilent) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 ml of the non-stressed culture was added to 1 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... Flow-through was mixed 1:1 with 70% ethanol and passed through a RNeasy Mini column (Qiagen, #74104). After centrifugation ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼8 ml PCR product (azide-DNA:2xbiotin-DNA = 1:1) was purified using HiSpeed Plasmid Maxi kit (Qiagen) in 1 ml NaHCO3 (pH 8.3) ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-His tag (1:2000; QIAGEN) and rabbit anti-GST (1:2000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA) (Qiagen, Hs_PLCE1_1, SI00115521); negative control siRNA (UUCUCCGAACGUGUCACGUdTdT ...
-
bioRxiv - Microbiology 2020Quote: ... 1× Qiagen Multiplex Master Mix (QIAGEN, Germany) and 5 μL of template DNA in a 15 μL reaction ...
-
bioRxiv - Developmental Biology 2022Quote: ... containing DNase I (1 mg/ml, Qiagen) at 37 °C for 5 min with gentle shaking ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 ml of Proteinase K (Qiagen, 19131) was added to the tube and vortexed for 5 seconds ...
-
bioRxiv - Systems Biology 2022Quote: ... resuspended in 1 mL QIAzol reagent (Qiagen) and stored at -80 °C.
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-His from Qiagen (1:10,000), home-made rabbit anti-VASH1 ...
-
bioRxiv - Cancer Biology 2019Quote: ... diluted 1:8 in PKD buffer (Qiagen) at 56°C for 1 hour with interval shaking ...