Labshake search
Citations for Qiagen :
1401 - 1450 of 2379 citations for 6 Oxa 7 azatricyclo 3.3.0.02 4 oct 7 ene 8 1 methylethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... The product was purified from a 1% agarose gel (QIAquick Gel Extraction Kit, Qiagen).
-
bioRxiv - Microbiology 2022Quote: ... The resulting supernatant was supplemented with 1 mL pre-equilibrated Ni-NTA resin (Qiagen) and 10 mM imidazole and stirred for 30 min at 4 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... and homogenized for 1 cycle with a Bead Beater TissueLyser II (QIAGEN, Germantown, MD) at 25 Hz for 1.5 min ...
-
bioRxiv - Microbiology 2022Quote: ... Clarified lysate was added to 1 mL of washed Ni-NTA bead slurry (Qiagen) and incubated for 1 hour at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... Blots were probed with antibodies against His6 (penta-His Qiagen catalog #34460; 1:10,000), FLAG2 (Sigma catalog #A8592 ...
-
bioRxiv - Immunology 2019Quote: ... Cells were sorted into PBS/1% FBS before resuspension in Buffer RLT (QIAGEN, USA) or directly into Buffer RLT with 1% 2-β-mercaptoethanol (Sigma ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant GST-Dnmt5(1-150)-6xHis was purified with Ni-NTA agarose resin (Qiagen), measured by A280 (ε = 66,030 cm-1 M-1) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant MBP-Dnmt5(1-150)-6xHis was purified with Ni-NTA agarose resin (Qiagen), measured by A280 (ε = 89,590 cm-1 M-1) ...
-
bioRxiv - Microbiology 2019Quote: ... The Ni-NTA matrix was loaded on a prepared 1 ml Polypropylene column (Qiagen) and a filtered P ...
-
bioRxiv - Paleontology 2019Quote: ... plasmid minipreps were purified with a QIAprep Miniprep Kit (Qiagen, chimpanzee 1 and 2), and RBC Miniprep Kit (YPD100 ...
-
bioRxiv - Genomics 2019Quote: ... Lysis reactions were neutralized by adding 1 μL neutralization buffer (stop solution, Qiagen, Germany). Both ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNAs were synthesized from ∼1 µg total RNA using QuantiTect Reverse Transcription kit (QIAGEN) according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2020Quote: ... 1 mL of each culture was added to 2 mL RNAprotect Bacteria Reagent (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... 0.5% (v/v) Triton X-100) and 1 mg/ml Proteinase K (QIAGEN, Germany). The solution was incubated at 55°C for 15 min ...
-
bioRxiv - Microbiology 2019Quote: ... mixed at a ratio of 1:10 with QIAzol lysis reagent (Qiagen, Cat: 79306) and homogenized by bead beating (FastPrep-24 Instrument ...
-
bioRxiv - Genomics 2021Quote: ... 1 mM EDTA (pH 7.5) and purified on a Genomic-tip 100/G (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and stored in either 1 ml Cell Lysis Solution (Gentra Puregene Kit, Qiagen, USA), Queen’s buffer ...
-
bioRxiv - Microbiology 2020Quote: ... HIV-1 RNA was analyzed using the QuantiTect SYBR Green RT-PCR kit (Qiagen) in a LightCycler 480 (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... The soluble extracts were applied to a 1 ml of Ni2+- NTA-agarose (Qiagen) column that had been equilibrated with buffer A containing 10 mM imidazole ...
-
bioRxiv - Molecular Biology 2021Quote: RNA was extracted from approximately 1×106 cells using the RNeasy Mini kit (Qiagen). DNA was digested using the TURBO DNA-free Kit (Ambion) ...
-
bioRxiv - Immunology 2021Quote: ... Each tissue was collected into a microcentrifuge tube containing 1 mL of Qiazol (Qiagen) and autoclaved glass beads ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized from 1 μg total RNA using the QuantiTect RT kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... 1 x 75 bp next generation sequencing of placental microRNA was performed by Qiagen Genomic Services (Frederick ...
-
bioRxiv - Biochemistry 2021Quote: ... precleared lysates were mixed with 1 ml Ni-NTA-agarose beads (Qiagen; Hilden, Germany) and incubated for 1 h rotating at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... washed in PBS and treated with 1:100 volume of RNase-free DNase (QIAGEN) and DMEM media for 30min at 37°C in the incubator ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50 mg tumor tissue was mechanically homogenized in 1 ml Qiazol (Qiagen, Hilden, Germany), whereas cells were lysed in 1 ml Qiazol by resuspending ...
-
bioRxiv - Cell Biology 2022Quote: Reverse transcription was carried out using the miRCURY LNA™1 RT Kit (Qiagen) using 10 ng of RNA according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: Total RNA was isolated from 1 million cells using the RNeasy Mini kit (Qiagen), according to the manufacturers’ protocols ...
-
bioRxiv - Microbiology 2023Quote: ... and a 1 kb band was purified using the Qiaquick Gel Extraction Kit (Qiagen) and cloned into pCR2.1 TOPO cloning vector ...
-
bioRxiv - Plant Biology 2023Quote: ... per 1 ml buffer RLC and on-column Dnase digestion with Dnase I (Qiagen). First-strand cDNA was synthesized from 1 μg of total RNA using a Thermo Scientific RevertAid RT Kit (Thermo Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... After incubation with the primary antibody from QIAGEN (Penta-His Antibody, 1:1000 dilution) at RT for 1 h under shaking ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μg mRNA per sample was used to perform reverse transcription (Qiagen, Cat. # 205311). Gene expression levels were then detected using SYBR Green (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2023Quote: Approximately 5 mg of frozen liver was homogenized in 1 ml RLT buffer (Qiagen) using a BeadBeater (BioSpec ...
-
bioRxiv - Pathology 2023Quote: ... was used to transfect HMEC-1 with siRNA control or siRNA MC1R oligonucleotides (Qiagen) (20 nM final concentration).
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was then incubated with 1 mL of Ni-NTA beads (Qiagen, USA) while rotating for 2 h at 4°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... three kits were used: (1) Qiagen DNeasy Blood & Tissue Kits (Qiagen, cat. no. 69504) for DNA extraction and (2 ...
-
bioRxiv - Bioengineering 2023Quote: ... Total RNA was collected and purified using the RNeasy Mini Kit Part 1 (Qiagen). The total RNA concentration was quantified using a Nanodrop spectrophotometer ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was then incubated with 1 mL of Ni-NTA beads (Qiagen, USA) while rotating for 2 h at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... cDNA was prepared from 1 µg of RNA using QuantiNova Reverse Transcription Kit (Qiagen). SYBR Green I Master (Roche ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Genomic DNA was extracted from 1 mL of culture (DNeasy Blood & Tissue Kit; Qiagen) and quantified on a Nanodrop ...
-
bioRxiv - Systems Biology 2024Quote: ... Following a 2-hour RNase A treatment (Qiagen, 100 mg/ml, 1:1,000 dilution) at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was then incubated with 1 mL of Ni-NTA beads (Qiagen, USA) while rotating for 2 h at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 15 µl of siRNA (1 µM, FlexiTube GeneSolution, Qiagen, Hilden, Germany, see Table S1) were diluted in 1.5 ml culture medium without supplements ...
-
bioRxiv - Molecular Biology 2023Quote: ... and pre-hybridized for 1 hour at 65 degrees in 1X ISH buffer (Qiagen). Digoxigenin-labeled LNA probes against mito-tRNA Asn and nuclear-encoded tRNA Asn designed by Qiagen (sequences in supplementary methods ...
-
bioRxiv - Immunology 2023Quote: ... ∼1000 macrophages were sorted into 75µL of RLT buffer (Qiagen, containing 1% beta-mercaptoethanol), vortexed for 1 min and immediately frozen (–80°C) ...
-
bioRxiv - Genomics 2024Quote: ... 500 µl liquid culture were mixed well with 1 ml RNAprotect Bacteria Reagent (Qiagen) and incubated for 5 min ...
-
bioRxiv - Neuroscience 2024Quote: ... RT-PCR was normalized using the housekeeping genes hypoxanthine phosphoribosyl-transferase 1 (HPRT1, Qiagen QuantiTect Primer Assay ...
-
bioRxiv - Cell Biology 2024Quote: RNA was isolated from RPE-1 cells using the RNeasy mini kit (Qiagen, CA) and cDNA was generated using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... Total DNA was extracted from 1 ml liquid samples using DNeasy Blood & Tissue kit (Qiagen). The variable ends of subtype II-C and type VI-B loci (C1 and C2 ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...