Labshake search
Citations for Qiagen :
1351 - 1400 of 4028 citations for 7 Chloro 1 3 dihydro 5 phenyl 2H 1 4 benzodiazepin 2 thione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... Results were analysed with the PyroMark Q24 software (version 2.0.8, build 3, Qiagen). DNA methylation values obtained via pyrosequencing were compared between the HS and Control groups using a Wilcoxon test.
-
bioRxiv - Systems Biology 2020Quote: ... the MoBioPowersoil 96 kit (now Qiagen Cat No./Id: 12955-4) was used with minor modifications ...
-
bioRxiv - Genomics 2021Quote: ... 4 μL of Buffer D2 (REPLI-g Single Cell Kit, Qiagen) and 1 μL of 500 μM exonuclease-resistant random primer were then added to the lysed cells to denature the DNA prior to vortexing ...
-
bioRxiv - Cell Biology 2022Quote: ... and TBT (4 biological replicates per condition) with RNeasy columns (Qiagen), followed by oligo-dT selection ...
-
bioRxiv - Systems Biology 2023Quote: ... or 4 pmol total negative control siRNA (Allstars negative control, Qiagen), were transfected using the Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were separated on 4-12% Bis-Tris gels (Novex, Qiagen) using MOPS running buffer (Novex ...
-
bioRxiv - Cell Biology 2020Quote: One colony per clone corresponding to ∼2×104 cells and 2×103 primary cells of each individual were lysed in RLT Plus (Qiagen) and stored at −80°C until processing ...
-
bioRxiv - Neuroscience 2021Quote: Total brain RNA from 21 days old Itm2bD/D and Itm2bww/ rats (2 male and 2 females per each genotype) was extracted with RNeasy RNA Isolation kit (Qiagen). Standard RNA-Seq procedures and data analysis was performed by Genewiz following proprietary methods (https://cdn2.hubspot.net/hubfs/3478602/NGS/RNA-Seq/GENEWIZ_RNA-Seq_Technical_Specifications_US.pdf) ...
-
bioRxiv - Microbiology 2021Quote: Swab RNA was extracted from 0.2 ml of swab solutions (1ml of DMEM with 2% fetal bovine serum [Cytiva]) using QIAamp Viral RNA Minikit (QIAGEN) and subjected to real-time RT-PCR for viral RNA quantitation [40] using QuantiTect Probe RT-PCR Kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was isolated from cultures infected with rVSV/SARS-CoV-2/GFP1D7 and rVSV/SARS-CoV-2/GFP2E1 using the QIAamp Viral RNA mini kit (Qiagen) and cDNA synthesis was performed using SuperScript III using hexamers (ThermoFisher) ...
-
bioRxiv - Genetics 2021Quote: ... ThermoScientific catalog numbers A32955 and 78420)) using a bead mill with steel beads (2 x 2 min at 20 Hz; TissueLyser, Qiagen). Extracts were cleared by centrifugation (17,000 RCF ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was isolated from control (n = 2) and olaparib-treated (n = 2) GTFB-PDX1009 ascites using the RNeasy Plus Mini kit (Qiagen). RNA quality was confirmed using an Agilent TapeStation and all RNA used for library preparation had a RIN>9 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We carried out four separate extractions from spleen (N=2) and liver (N=2) tissue with MagAttract HMW DNA Kit (QIAGEN). We also performed a fifth extraction with spleen tissue using Monarch® HMW DNA Kit (New England BioLabs ...
-
bioRxiv - Genomics 2021Quote: ... Samples were treated with 2 µg RNaseA (Qiagen) and DNA was purified using the QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Genomics 2019Quote: ... 2) purifying twice using gDNA-eliminator columns (QIAGEN) before and after DNase treatment followed by RNeasy column purification (QIAGEN) ...
-
bioRxiv - Cell Biology 2020Quote: ... and Mm Aldoa 2 FlexiTube siRNA (Qiagen, SI00896238) according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: 2 mL of Ni-NTA resins (Qiagen, USA) were packed into a 5 mL column ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 2) DNeasy Blood and Tissue Kit (Qiagen, Germany); 3 ...
-
bioRxiv - Immunology 2023Quote: ... 2 ml of Ni-NTA Agarose (Qiagen, 30310) was added per 50 ml of supernatant and the mix was left on a rolling platform at 4°C overnight ...
-
bioRxiv - Immunology 2024Quote: 2 ml MaXtract High Density tubes (Qiagen, 129056) were centrifugated at 12,000–16,000 × g for 20-30 second centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... with Negative Control GapmeR A (30300019-2, Qiagen) using 3.5 μL of Lipofectamine 2000 in Opti-MEM I reduced serum medium following the manufacturer’s suggested protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Wells contained 5 μl/well TCL-buffer (QIAGEN, cat. 1031576) with 1% 2-Mercaptoethanol ...
-
bioRxiv - Microbiology 2019Quote: ... each along with 5 mm diameter stainless steel beads (QIAGEN). The TissueLyser II (QIAGEN ...
-
bioRxiv - Molecular Biology 2019Quote: ... using mechanical disruption with 5 mm stainless steel beads (Qiagen) on a Tissue Lyser II (Qiagen) ...
-
bioRxiv - Plant Biology 2020Quote: ... 0.12 units of Taq DNA polymerase (Qiagen, 5 units/μL) and 14.44 μL of ultra-pure water ...
-
bioRxiv - Microbiology 2021Quote: ... was added to a column (Qiagen, 5 mL polypropylene column), equilibrated with lysis buffer ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... bead mill with 5-mm stainless-steel beads (Qiagen, #69989). Homogenates were centrifuged at 16,000 g for 5 minutes ...
-
bioRxiv - Immunology 2021Quote: ... and 5 mm stainless steel beads (Qiagen, Cat No. 69989) and briefly centrifuged ...
-
bioRxiv - Microbiology 2020Quote: ... 5) Powersoil® Isolation kit (MO Bio Laboratories/Qiagen, Canada) with modifications ...
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... bead mill with 5-mm stainless-steel beads (Qiagen, #69989). Insoluble debris was pelleted by centrifugation ...
-
bioRxiv - Cancer Biology 2024Quote: ... along with a pre-chilled 5-mm steel bead (QIAGEN). All samples were then placed in pre-chilled cassettes for the Tissue Lyser II and pulverized for at 30 1/s for three 1-minute oscillations ...
-
bioRxiv - Microbiology 2023Quote: ... with two 5-minute cycles on a TissueLyser II (Qiagen) separated by a 5-minute incubation on ice ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mL erythrocyte lysis buffer (EL buffer, Qiagen, Hilden, Germany) was added and PMNs were centrifuged ...
-
bioRxiv - Biochemistry 2024Quote: ... a 5 mL Ni2+-NTA HisTrap fast flow column (Qiagen) was equilibrated with 10 mL of buffer containing 20 mM Tris HCl pH 7.5 ...
-
bioRxiv - Microbiology 2020Quote: ... Total DNA was extracted from 1 ml liquid samples using DNeasy Blood & Tissue kit (Qiagen). The variable ends of subtype II-C and type VI-B loci (C1 and C2 ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Microbiology 2021Quote: ... The qPCR reaction mixture (10 μL) comprised 1× Rotor-Gene SYBR green PCR mix (Qiagen), 500 nM of each primer ...
-
bioRxiv - Genomics 2020Quote: RNA was purified from approximately 1 × 107 CHM13 cells using an RNeasy kit (Qiagen; 74104) and prepared into Iso-Seq libraries following a standard protocol68 ...
-
bioRxiv - Genomics 2020Quote: ... S2 cells were transfected with 1 ug plasmid DNA using the Effectene reagent kit (Qiagen). The plasmid DNA which contains cDNA of FLAG-tagged ECDs are under the metallothionein promoter control ...
-
bioRxiv - Molecular Biology 2021Quote: ... Unbound Biotin-HPDP was removed by chloroform/isoamylalcohol (24:1) extraction in MaXtract tubes (Qiagen). RNA was precipitated with 10th volume of 5M NaCl and 1 volume of isopropanol ...
-
bioRxiv - Molecular Biology 2021Quote: ... The backbone was extracted from a 1% agarose gel using QIAquick Gel Extraction Kit (Qiagen) and the minigene insert was cleaned up using QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Biophysics 2019Quote: ... proteins were purified by batch Ni-NTA bead purification (1 mL slurry/1L culture; Qiagen) and further purified by a Superdex 200 16/60 column (GE Healthcare ...
-
bioRxiv - Cancer Biology 2019Quote: ... following the manufacturer’s instructions and treated twice with DNase I (1 unit/µg RNA, Qiagen). The RNA concentration was quantified using nanodrop2000 (Thermo Fisher ...
-
bioRxiv - Plant Biology 2019Quote: ... with 1 min shaking at 25 Hz in the Tissue Lyser II (Qiagen, Hilden, Germany). Ground tissue was stored at −80 °C ...
-
bioRxiv - Genetics 2019Quote: ... DNA from FFPE sample 6005-1 was extracted using QIAamp DNA FFPE Tissue Kit (Qiagen). Genomic DNA and RNA were extracted from peripheral blood leukocytes from patient 6003 and from a non-HHT control individual using the Gentra PureGene Blood Kit (Qiagen ...
-
bioRxiv - Genomics 2020Quote: ... The supernatant of cell lysate was incubated with 1 mL Ni-NTA agarose beads (QIAGEN) at 4 °C for 1 h ...
-
bioRxiv - Immunology 2019Quote: ... Purified RNA (1 μg) was reverse-transcribed to cDNA using RT2 First Strand Kit (Qiagen, Hilden ...
-
bioRxiv - Cell Biology 2019Quote: ... Co-NTA beads were obtained from stripping 1 mL of Ni-NTA resin from Qiagen in a Bio-rad gravity column with 50 mL of 0.5M EDTA (pH 8.0) ...
-
bioRxiv - Bioengineering 2020Quote: Genomic DNA was isolated from 1×106 tumor cells using DNeasy Blood & Tissue Kit (Qiagen). BCMA and CS1 loci amplicons ...
-
bioRxiv - Neuroscience 2020Quote: ... then converted to cDNA using 1 µg RNA and a QuantiTect Reverse Transcription kit (Qiagen) according to manufacturer’s instructions ...