Labshake search
Citations for Qiagen :
1351 - 1400 of 2828 citations for 3 3 2 3 Dimethyl indol 1 yl 2 hydroxy propylamino propan 1 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... preceded by a 10-minute bead-beating step at 30 Hz in 2 ml e-matrix tubes (MP Biomedical, USA) using a Tissuelyser II (Qiagen). Molarity and fragment-length distribution of the extracts were measured using a Tapestation ...
-
bioRxiv - Microbiology 2024Quote: ... The filtrate was transferred to ultra-clean 2 mL tubes and 280 µL were collected for nucleic acid extraction using the QIAamp Viral RNA mini kit (Qiagen). The extract was eluted in a final volume of 40 µL and stored at -80 °C.
-
bioRxiv - Molecular Biology 2024Quote: ... and 8 liver samples (2 from each lobe) were obtained on necropsy and processed with the DNeasy Blood and Tissue Kit (QIAGEN) as per the manufacturer’s instructions to isolate genomic DNA ...
-
bioRxiv - Immunology 2024Quote: ... Expression of target ncRNAs in CH12F3 and primary B cells were inhibited by 2 µM miRCURY LNA miRNA Inhibitors (339131, Qiagen), anti-miR-5099 (GGAGCACCACATCGATCTAA-FAM) ...
-
bioRxiv - Immunology 2024Quote: ... Overexpression of miR-5099 in CH12F3 was achieved by transfecting 2 µM of miR-5099 miRCURY LNA miRNA mimic (Qiagen) by electroporation using Lonza 4D-Nucleofector and cell line SF kit following manufacturer’s protocol.
-
bioRxiv - Microbiology 2024Quote: ... Parasite genomic DNA was extracted from the mouse blood sampled after feeding the mosquitoes (Barcode input 2) using DNeasy Blood and Tissue Kit (Qiagen). The parasite gDNA was extracted from the infected mosquito midguts 14 days post-infection (Barcode output ...
-
bioRxiv - Developmental Biology 2024Quote: ... approximately 2×106 cells per well were washed with cold PBS and lysed using Buffer RLT (Qiagen, catalog no. 79216). RNA extraction was performed according to the manufacturer’s protocol (RNeasy Mini Kit ...
-
bioRxiv - Genetics 2024Quote: ... DNA samples (70–80 oocytes and 7–10 blastocysts per sample) were subjected to bisulfite conversion through 2 µg carrier RNA (QIAGEN). Nested PCR was performed using EpiTaq HS with the primers listed in Supplementary Table 4 ...
-
bioRxiv - Genomics 2024Quote: ... The amplicon library pools were isolated based on size by gel electrophoresis using a 2% agarose gel and then purified using QIAEX II Gel Extraction Kit (QIAGEN) and using 30uL of QIAEX II beads for each sample ...
-
bioRxiv - Microbiology 2024Quote: ... The reaction was incubated at 37°C for 2 hours and RNA transcripts were then purified using the RNeasy MinElute Cleanup Kit (Qiagen). Concentrations of purified RNA were determined using a DS-11 FX+ Spectrometer/Flourometer (DeNovix).
-
bioRxiv - Physiology 2024Quote: ... was mechanically homogenised in TRI reagent with a 5 mm steel bead at 30 Hz for 2 x 30 s (TissueLyser II, Qiagen) then centrifuged for 10 min at 10,000 g ...
-
bioRxiv - Neuroscience 2024Quote: Cortical brain tissue was homogenised in TBS (with cOmplete mini protease inhibitor cocktail) for 2 minutes at 200 Hz using Tissue Lyser II (Qiagen), centrifuged at 31,000 g for 1 hour at 4°C ...
-
bioRxiv - Physiology 2024Quote: ... weighed and homogenized 1:180 (weight:volume, mg:µL) in homogenization buffer (50 mM Triethanolamine and l mM EDTA) with 2 tungsten beads (Qiagen, Cat. #69997) using a Tissue Lyser (Qiagen Cat ...
-
bioRxiv - Neuroscience 2024Quote: BV-2 cells and primary mouse astrocytes were harvested and RNAs were extracted using the RNeasy Kit (Qiagen, Hilden, Germany) following the manufacturer’s directions ...
-
bioRxiv - Immunology 2024Quote: The expressions of 84 innate and adaptive immune genes in the lungs of SARS-CoV-2 infected mice and Sham were determined using RT2 ProfilerTM PCR array kit (Cat#: PAMM-052ZC-24, Qiagen) 39 ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was extracted from cells harvested at three days or 2 weeks post nucleofection using the RNeasy plus kit (Qiagen) as per the manufacturer’s instructions and quantified by nanodrop ...
-
bioRxiv - Physiology 2024Quote: ... RNA was isolated from pooled vessels (4 renal arteries or 2 mesenteric arteries) using the RNeasy Micro kit (Qiagen, USA), quantified by the NanoDrop-1000 (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was isolated from both J-Lat and C J-Lat cells by lysing 2 x 106 cells using the AllPrep DNA/RNA Mini Kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... was reverse transcribed at 37 °C for 2 h in a 20 μL reaction volume containing 4 U of Omniscript reverse transcriptase (Qiagen), 0.5 mM each dNTP ...
-
bioRxiv - Microbiology 2024Quote: ... DNA fragments were separated on a 2% agarose gel and fragments from 600-800 base pairs were isolated using the QIAquick Gel Purification Kit (Qiagen). Fragments were then amplified by 15 cycles of PCR and sequenced using Illumina sequencing at the Tufts Core Facility (Boston ...
-
bioRxiv - Genomics 2024Quote: ... were pooled together equimolarly and the final product was purified from a 2% agarose gel with 20 μl silica beads (QIAEX II Gel Extraction Kit, Qiagen). The three random libraries were purified individually ...
-
bioRxiv - Genomics 2024Quote: Frozen tissues were ground in liquid nitrogen using a mortar and pestle or homogenised in 2 mL tubes using a TissueLyzer instrument (Qiagen) immediately prior to DNA extraction ...
-
bioRxiv - Synthetic Biology 2024Quote: ... two small lab spoons (5 mm) of biomass were transferred to a 2 mL screw cap tube with a steel bead inside (5 mm; Qiagen) and frozen using liquid nitrogen ...
-
bioRxiv - Biophysics 2024Quote: ... The final pools were purified from a 2% agarose gel using a silica beads extraction kit (QIAEX II Gel Extraction Kit, Qiagen).
-
bioRxiv - Biochemistry 2024Quote: ... The lysate was then cleared by centrifugation at 42,000 ξ g for 50 min at 4°C before being applied to 2 mL of Ni-NTA resin (QIAGEN) in a gravity flow column ...
-
bioRxiv - Biochemistry 2024Quote: ... Eluted complex was then mixed to 6 μL of 5 M NaCl and 2 μL of 100 mg/mL RNase A (Qiagen) and incubated overnight at 65°C to reverse cross-linking and digest RNA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... for 20 min at 37 °C (2 units per sample) was followed by purification using the RNeasy minElute Cleanup kit (Qiagen). RNA quality of all samples was checked using the Agilent 2100 Bioanalyzer with an Agilent RNA 6000 Nano Kit ...
-
bioRxiv - Genetics 2024Quote: ... which was then homogenized in a 2 mL tube containing a sterile glass bead using a TissueLyser (QIAGEN, Aarhus, Denmark) in two cycles at 30 Hz for 30 seconds ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... For DNA extraction approximately 2 mm3 of wing muscle tissue was removed from the thorax and processed using DNeasy Blood and Tissue Kits (Qiagen) following standard manufacture protocols ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extract (1 mg) was incubated with His6-RabD2c (1 μg) and Ni-NTA Agarose (QIAGEN) for 1 h at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA of FocnCong:1-1 was isolated using CTAB and 100/G genomic tips (QIAGEN) as described in the 1000 Fungal genomes project (http://1000.fungalgenomes.org) ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated for 1 h at 55°C with 20 mg ml−1 proteinase K (Qiagen). Samples were treated for 10 min at 65 °C with 4 μl RNase A (100 mg ml−1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µl 10x Taq buffer (Qiagen), 0.08 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of non-tailed primer ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of each of microsatellite forward and reverse primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μM template-switching oligonucleotides (QIAGEN), and 1 M betaine (Sigma 61962) ...
-
bioRxiv - Cancer Biology 2021Quote: ... HIS-tag (Qiagen 34610 1:100) and HER3 (R&D Systems AF4518 1:400) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 µM template-switching oligonucleotides (QIAGEN), and 1 M betaine ...
-
bioRxiv - Cell Biology 2021Quote: βPix siRNA – #1 - AACAATCAACTGGTAGTAAGA (Qiagen S104239011), #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen) and 0.2 μM of each primer pair ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 x Qiagen PCR Buffer (Qiagen), 3 U APEX Taq (Genesee Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing 1 ml InhibitEx buffer (Qiagen). Two rounds of bead incubations were applied at 3.5 m/s for 2 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 5ug of Ribonuclease 1 (Qiagen, 19101) was added to each sample followed by staining with 20ug propidium iodide (Thermo Scientific ...
-
bioRxiv - Systems Biology 2024Quote: ... NTA-agarose resin (1 mL) (Qiagen) was washed twice with 3 ml of distilled water and 2 ml of 100 mM FeCl3 in 0.1% acetic acid was added ...
-
bioRxiv - Developmental Biology 2024Quote: ... SFPQ siRNA #1 (Qiagen Cat#SI05783848), and SFPQ siRNA #2 (Qiagen Cat#SI05783876 ...
-
bioRxiv - Plant Biology 2024Quote: ... mixed with 1% beta-mercaptoethanol (Qiagen) using Kimble Chase glass tissue grinders (part# KT885450-0020) ...
-
bioRxiv - Plant Biology 2020Quote: ... a 2 ml subsample of the coarse powder was ground to a fine powder using a Qiagen TissueLyser (Qiagen, Germantown, MD). Finely powdered leaf tissue was then sent to Midwest Laboratories (Omaha ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant containing solubilized protein was filtered using a 0.22 μM nylon membrane filter and incubated with 2 ml of nickel-nitrilotriacetic acid (Ni-NTA) resin (Qiagen, Germantown, MD) at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Cell Biology 2022Quote: ... RNA was extracted from infected or mock-treated Caco-2 cells using the Qiagen RNAeasy Plus Extraction Kit (Qiagen, Hilden, Germany). For quantifying the SARS-CoV-2 genome abundance in mock and infected samples ...