Labshake search
Citations for Qiagen :
1301 - 1350 of 2556 citations for 2 Amino 6 chloro 9 3 5 di O p toluoyl beta D 2 deoxyribofurnanosyl purine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... using a TissueLyser II (3 min, 30 Hz; Qiagen). After vigorous mixing with chloroform at a 1:4 v/v ratio (chloroform:TRIzol) ...
-
bioRxiv - Genomics 2021Quote: ... 3 μl of nuclease free water (Qiagen, Hilden, Germany) and 5 μl of template containing cDNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 volumes of QIAzol® (Qiagen, Cat. No. 79306) were added to 80 µl of cell extracts ...
-
bioRxiv - Immunology 2023Quote: ... using tungsten carbide beads (3 mm, Qiagen catalog #69997) and shaking (300 times per min ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 3 min in TissueLyser II (30 Hz; Qiagen). Cell lysates were centrifuged for 15 min (4 °C ...
-
bioRxiv - Physiology 2023Quote: ... using a TissueLyser II (3 min, 30 Hz; Qiagen). Lysates were centrifuged for 15 min (21,000 g ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Genomics 2021Quote: ... containing 5 µl RLT plus (Qiagen) with 1% v/v β-mercaptoethanol (Biorad) ...
-
bioRxiv - Developmental Biology 2023Quote: ... with one 5 mm (Qiagen, 69989) and three 2.8 mm metal beads (Precellys ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 µL RNase free water (Qiagen), 1 µL cDNA ...
-
bioRxiv - Microbiology 2021Quote: ... leaf-disc punches were collected from plants and ground in 250 µL of 10 mM MgCl2 using the TissueLyser II (QIAGEN; 2 cycles of 30 seconds at 25 Hz) and 3-mm zirconium oxide beads (Glen Mills Inc.) ...
-
bioRxiv - Microbiology 2021Quote: ... These cells were incubated overnight in MEM-α media free of FBS and supplemented with 1% P/S followed by collection of Supernatant (conditioned media) and total RNA extraction (Cat# 74134, Qiagen, Germany). The resulting samples were stored at −80°C until analyzed further in downstream applications.
-
bioRxiv - Genomics 2021Quote: ... or museum specimens deposited at the Paris (P) herbarium (11 extractions) using the CTAB protocol (Doyle and Doyle, 1987) or the DNeasy® Plant Mini Kit (Qiagen). We quantified DNA using the QuantiFluor® dsDNA system for a QuantusTM fluorometer (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... Genes with fold change >= 2 and adjusted p-value <0.05 were selected as DEGs and submitted to the Ingenuity Pathway Analysis (IPA) software (QIAGEN, CA, USA). The IPA graphical summary gives an overview of the main biological findings of the analysis.
-
bioRxiv - Cell Biology 2023Quote: ... Differential gene lists were created with ≥ 2 fold expression cutoff and significant p-values of < 0.05 were submitted to pathway analysis using Ingenuity Pathway Analysis (Qiagen, Germantown, MD) to identify pathways of interest that were modified by treatment with PAPA-NONOate.
-
bioRxiv - Cell Biology 2024Quote: Cells were washed once with D-PBS and lysed using QIAzol reagent (QIAGEN). Total RNA was extracted using the Direct-zol RNA Miniprep kit (Zymo Research) ...
-
bioRxiv - Microbiology 2023Quote: ... incubated at 65°C for 5 min and beaten for 5 min in a bead beater (Qiagen) set at high speed ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 6 µM and harvested 24 h later by adding RLT lysis buffer (Qiagen). Similarly ...
-
bioRxiv - Neuroscience 2021Quote: ... tissue from 6 brains were pooled to prepare total RNA (RNEasy micro kit, Qiagen) for reverse transcription and amplification to cDNA (Ovation Pico WTA kit ...
-
bioRxiv - Immunology 2021Quote: ... and harvested for RNA extraction after 6 hours of incubation using RNAeasy kits (Qiagen). cDNA was synthesized from 500 ng of RNA using Quantitect Reverse Transcriptase kits (Qiagen) ...
-
bioRxiv - Biochemistry 2022Quote: ... IL −6 and TNFα mRNA were detected by validated QuantiTect primer assays 144 (Qiagen).
-
bioRxiv - Biophysics 2023Quote: TSA measurements were carried out on a Rotor-Gene Q 6 plex (Qiagen, Germany) instrument at a heating rate of 2 °C/min and a temperature range of 25−90 °C in the presence of a CPM dye ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 nM siRNAs were mixed with 6 µl of HiPerFect transfection reagent (Qiagen, #301707) in 100 µl of serum free DMEM and added to freshly plated cells drop by drop ...
-
bioRxiv - Microbiology 2024Quote: ... Tissues were homogenized at 300 Hz for 6 minutes using the TissueLyser II (QIAGEN). Homogenized samples were serially diluted at 1:10 in PBS ...
-
bioRxiv - Neuroscience 2024Quote: Total RNA was purified from 6-week-old GABAergic neurons using Rneasy kit (Qiagen). Dnase I on-column digestion was performed to avoid genomic DNA contamination.
-
bioRxiv - Cancer Biology 2022Quote: ... and 3 µg pINDUCER20-GFP-AFOS using PolyFect (Qiagen, 301107). Media was collected at 48 and 72 hours post-transfection and viral particles were precipitated using PEG-it™ Solution (System Biosciences ...
-
bioRxiv - Plant Biology 2022Quote: ... Hoko-3 using a Genomic-tip kit (Qiagen, Hilden, Germany). Library preparation was performed using SMRTbell Express Template Prep Kit 2.0 (PacBio ...
-
bioRxiv - Biochemistry 2023Quote: ... and mixed with 3 mL of Ni-NTA resin (Qiagen) for 1.0 h at 4 °C and then applied to a gravity flow column ...
-
bioRxiv - Molecular Biology 2024Quote: ... were crushed with a tungsten carbide bead (3 mm, Qiagen) on a Retsch MM400 mixer mill for 60 seconds at 30 Hz and DNA was extracted using the DNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... an aliquot (5 µL) was treated with 0.5 µL of 5 mg/ml RNase A (QIAGEN, Hilden, Germany) at 37 °C for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... 68°C for 60 s and a final extension cycle of 68°C for 7 min. Amplified PCR products (approx. 429 bp for P gene) were gel purified using QIAquick gel extraction kit (QIAGEN, Hilden, Germany) and sequenced using BigDye Terminator v3.1 Cycling Sequencing Kit (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... expression fold changes and p-values generated from differential expression analyses were imported into Ingenuity Pathway Analysis software (IPA, Qiagen, RRID: SCR_008653). Core expression analysis was performed which generated canonical pathways which were upregulated or downregulated based on these data ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... was extracted from the blood (N. scutatus) or tail clip (P. textilis) using the genomic-tip 100/G kit (Qiagen, Hilden, Germany). This was performed with proteinase K (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... The final data set (including the fold ratio change of each group compared to healthy and p-values) was further analysed in the Ingenuity Pathway Analysis software (IPA®, Qiagen, UK), where canonical pathways and upstream regulator data were compared by their activation z-score and associated p-value ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of RLT plus buffer (QIAGEN) and 60 fg of λ-DNA were added into each isolated nucleus to lyse nucleus completely ...
-
bioRxiv - Immunology 2021Quote: ... 5 ml packed Ni-NTA resin (Qiagen) were equilibrated in lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl RT primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mm stainless steel beads (Qiagen). Phase separation was done by mixing 100 μl of Chloroform followed by centrifugation at 12000xg for 15 min in 4°C ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5 mm stainless steel beads (Qiagen). Sections were homogenized using a tissue lyser (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...
-
bioRxiv - Immunology 2020Quote: ... or a 5 mm steel ball (Qiagen). For tissues ...
-
bioRxiv - Genetics 2020Quote: ... using 5 mm stainless steel bead (Qiagen) at 20 Hz for 4 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 5 volumes of PB Buffer (Qiagen 28004) were added ...
-
bioRxiv - Immunology 2021Quote: ... using 5 mm stainless steel beads (Qiagen). RNA was extracted by the chloroform/isopropanol method and converted to cDNA as previously described ...