Labshake search
Citations for Qiagen :
1251 - 1300 of 10000+ citations for Estriol ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... or the DNeasy Blood & Tissue Kit (Qiagen). A 1048 bp region spanning the gene drive target site was amplified using primers Seq-7280-F (GCACAAATCCGATCGTGACA ...
-
bioRxiv - Cancer Biology 2019Quote: ... RNA was extracted (Qiagen RNeasy mini kit) and purity was confirmed using an Agilent Bioanalyzer ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... using DNeasy Blood and Tissue kit (QIAGEN) following the manufacturer instructions ...
-
bioRxiv - Genomics 2019Quote: ... or QIAsymphony DSP DNA Mini Kit (Qiagen) as described by the manufacturer ...
-
bioRxiv - Neuroscience 2019Quote: ... The RNeasy Mini Kit (Qiagen, Germantown, MD) was used to extract RNA according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... purified using a PCR Purification Kit (QIAGEN) and sub cloned into pGEM T-Easy vector I (Promega) ...
-
bioRxiv - Molecular Biology 2019Quote: ... the QIAquick PCR Purification kit (Qiagen, #28106) was used ...
-
bioRxiv - Genomics 2019Quote: ... destructor using QIAamp DNA Micro Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA was extracted (RNAeasy kit, Qiagen) and reverse-transcribed (iScript cDNA Synthesis Kit ...
-
bioRxiv - Microbiology 2019Quote: ... gel purified (MinElute Gel Extraction Kit, Qiagen) and loaded on an Illumina MiniSeq instrument in mid-output mode ...
-
bioRxiv - Systems Biology 2019Quote: ... using a RNeasy Mini Kit (Qiagen S.r.l.), following the manufacturer’s instruction ...
-
bioRxiv - Genetics 2019Quote: ... followed by the RNeasy Mini Kit (Qiagen). The samples were sent to the University of Exeter to perform the library preparation (ScriptSeq RNA-Seq Library Preparation Kit (Illumina) ...
-
bioRxiv - Bioengineering 2019Quote: ... using the Qiagen RNeasy kit (Qiagen 74104). cDNA was made from isolated RNA with the QuantiTect Reverse Transcription Kit (Qiagen 205310) ...
-
bioRxiv - Genetics 2019Quote: ... 1×106 cells using RNeasy Kit (Qiagen), followed by DNase digestion using TURBO DNase (Thermo Fisher) ...
-
bioRxiv - Plant Biology 2019Quote: ... and cleaned with RNeasy Mini kit (Qiagen). Samples were tested for possible DNA contamination by PCR using the RNA samples as templates and primers specific for M ...
-
bioRxiv - Developmental Biology 2019Quote: ... and the RNeasy Micro kit (Qiagen, 74004). 100 ng of RNA was used for RT-PCR with the SuperScript™ IV First-Strand Synthesis System (Invitrogen ...
-
bioRxiv - Genomics 2019Quote: ... and plasmid isolation (Qiagen Mini-Prep Kit).
-
bioRxiv - Neuroscience 2019Quote: ... and RNeasy mini Kit from (Qiagen: 74104) were used for the Cas9 mRNA ...
-
bioRxiv - Developmental Biology 2019Quote: ... column purified using RNeasy Mini Kit (Qiagen), and reverse transcribed using First Strand cDNA Synthesis Kit (Thermo Fisher) ...
-
bioRxiv - Immunology 2019Quote: RNA obtained using RNAeasy Mini kit (Qiagen) with DNAse treatment was reverse transcribed into cDNA (Fermentas ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA was extracted (RNAeasy kit, Qiagen) and reverse-transcribed (iScript cDNA Synthesis Kit ...
-
bioRxiv - Genomics 2019Quote: ... and MagAttract® HMW DNA kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... The RNeasy mini kit (Qiagen, CA, USA) was used according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and Plasmid Plus Maxi Kit (Qiagen, 12965) respectively ...
-
bioRxiv - Pathology 2020Quote: ... After purification using the MinElute Kit (Qiagen) and ligation of double-stranded P5 linker to cDNA ...
-
bioRxiv - Pathology 2019Quote: ... the DNeasy tissue kit (Qiagen, CA, 69506) was used to quantify DNA rickettsial DNA ...
-
bioRxiv - Immunology 2019Quote: ... or all-prep DNA/RNA kit (Qiagen). To assess genome editing ...
-
bioRxiv - Physiology 2020Quote: ... using QuantiNova SYBR Green PCR Kit (QIAGEN); 10 ng of cDNA per reaction was used in a total volume of 10 μl PCR reaction mixture ...
-
bioRxiv - Plant Biology 2020Quote: ... and the RNeasy Plant Mini kit (Qiagen) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... purified with RNeasy Mini Kit (Qiagen, Germany), and dissolved in RNase free Ultrapure water (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... the Ni-NTA Fast Start Kit (Qiagen) was applied according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2019Quote: ... and isolated (QIAprep spin miniprep kit, QIAGEN) following manufacturer instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... and a QIAprep Spin Miniprep Kit (Qiagen) was used to isolate each unselected library ...
-
bioRxiv - Systems Biology 2021Quote: ... using QuantitTect SYBR Green PCR kit (Qiagen). Amplification was normalized to GAPDH ...
-
bioRxiv - Molecular Biology 2020Quote: ... purified with a PCR purification kit (Qiagen) and cloned in the expression vector backbone (pCS2-HIS) ...
-
bioRxiv - Molecular Biology 2021Quote: ... prepared using the Plasmid Midi Kit (Qiagen), and transfected into 293FT cells using the Virapower packaging mix (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... amplified using a Pyromark PCR kit (Qiagen) and pyrosequenced on a PyroMark Q96 instrument (Qiagen) ...
-
bioRxiv - Cell Biology 2020Quote: ... and purified with the RNeasy kit (Qiagen). RNA quality was verified by microfluidic (Agilent 2100 Bioanalyzer ...
-
bioRxiv - Pathology 2020Quote: ... Qproteome FFPE tissue kit (Qiagen, Hilden, Germany) was used for deparaffinization and protein extraction ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1) DNeasy PowerLyzer PowerSoil Kit (QIAGEN®), 2 ...
-
bioRxiv - Microbiology 2020Quote: ... or QuantiTect Probe RT-PCR Kit (Qiagen) in a 12.5 μl reaction including 2.5 μl extracted DNA or RNA ...
-
bioRxiv - Microbiology 2020Quote: ... and cell lysate (RNeasy Mini Kit, Qiagen). All samples were collected in duplicate ...
-
bioRxiv - Microbiology 2020Quote: ... an RNeasy Mini Kit (Qiagen, Hilden, Germany) and an RNase-free DNase-free Kit (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... using the RNeasy Mini kit (Qiagen, Singapore). 1 μg of RNA was treated with DNase I ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... RNA was extracted using RNEasy kit (Qiagen) with the addition of Plant RNA isolation aid reagent (Thermo fisher ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted using DNeasy kits (Qiagen), Illumina library preparations were performed as described by Quail et al ...
-
bioRxiv - Microbiology 2021Quote: ... The Qiagen RNeasy Mini Kit (Qiagen, 74104) was subsequently used to process samples ...
-
bioRxiv - Molecular Biology 2020Quote: ... using QIAxcel RNA QC Kit v2.0 (Qiagen) and Qubit 3.0 fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... RNeasy Mini Kit DNase on column (QIAGEN) was used for DNase treatment.
-
bioRxiv - Genomics 2020Quote: ... The RNeasy Blood and Tissue Kit (Qiagen) was used according to manufacturer’s instructions ...