Labshake search
Citations for Qiagen :
1251 - 1300 of 3924 citations for 6 OXO 1 2 DIHYDRO 6H PYRROLO 3 2 1 IJ QUINOLINE 5 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... ∼8 ml PCR product (azide-DNA:2xbiotin-DNA = 1:1) was purified using HiSpeed Plasmid Maxi kit (Qiagen) in 1 ml NaHCO3 (pH 8.3) ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-His tag (1:2000; QIAGEN) and rabbit anti-GST (1:2000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA) (Qiagen, Hs_PLCE1_1, SI00115521); negative control siRNA (UUCUCCGAACGUGUCACGUdTdT ...
-
bioRxiv - Microbiology 2020Quote: ... 1× Qiagen Multiplex Master Mix (QIAGEN, Germany) and 5 μL of template DNA in a 15 μL reaction ...
-
bioRxiv - Developmental Biology 2022Quote: ... containing DNase I (1 mg/ml, Qiagen) at 37 °C for 5 min with gentle shaking ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 ml of Proteinase K (Qiagen, 19131) was added to the tube and vortexed for 5 seconds ...
-
bioRxiv - Systems Biology 2022Quote: ... resuspended in 1 mL QIAzol reagent (Qiagen) and stored at -80 °C.
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-His from Qiagen (1:10,000), home-made rabbit anti-VASH1 ...
-
bioRxiv - Cancer Biology 2019Quote: ... diluted 1:8 in PKD buffer (Qiagen) at 56°C for 1 hour with interval shaking ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 1 mL of Ni-NTA Agarose (Qiagen) was added to a 15 mL polypropylene gravity flow column (Qiagen) ...
-
bioRxiv - Genomics 2019Quote: ... and 1 U Taq DNA polymerase (Qiagen). A positive control of DNA extracted from commercially available Agaricus bisporus provided by Dr ...
-
bioRxiv - Genomics 2019Quote: ... and 1 U Taq DNA polymerase (Qiagen). The fungal-specific ITS1F/ITS4 and bacteria-specific 341F/805R primer pairs were used for each sample in two independent PCR reactions ...
-
bioRxiv - Genetics 2019Quote: ... 1×106 cells using RNeasy Kit (Qiagen), followed by DNase digestion using TURBO DNase (Thermo Fisher) ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 1 unit of HotStar Plus Taq (Qiagen), 200 nM of each primer ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM DTT using a TissueRuptor (Qiagen). The homogenate was then centrifuged 5 min at 2,500 x g at 4°C and the supernatant transferred to a new tube on ice followed by further homogenisation using a 27G needle and syringe ...
-
bioRxiv - Cancer Biology 2020Quote: ... diluted 1:8 in PKD buffer (Qiagen) at 56°C for 1 hour with interval shaking ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1) DNeasy PowerLyzer PowerSoil Kit (QIAGEN®), 2 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Ni-NTA agarose beads (1 ml; Qiagen), washed and resuspended in loading buffer (50 mM Tris ...
-
bioRxiv - Immunology 2021Quote: ... 1-unit HotStarTaq Plus (QIAGEN, Cat#: 203607), 190 nM 3’ primer pool ...
-
bioRxiv - Cell Biology 2021Quote: Myosin-18A siRNA – #1 CACGAACTGGAGATGGATCTA (Qiagen SI04273668), #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Cell Biology 2021Quote: ... 25 nM of S1PR1 #1 (Qiagen, #SI00376201) 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... stored in 1 ml RNAlater (Qiagen, Netherlands), and moved to a −20 °C freezer for up to a month until RNA was extracted ...
-
bioRxiv - Genetics 2019Quote: ... 1 μL of Q-Solution from Qiagen® and H2O ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 μM barcode LNA RT primer (Qiagen), 1U/μL RiboLock RNase inhibitor (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 uL ∼1.07 AU/mL Protease (Qiagen) was added to each well and incubated at 37 °C for 40 min ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 μL GlycoBlue coprecipitant (Qiagen; AM9515). RNA was precipitated after holding overnight at -80°C and centrifugation ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-RGS-His (Qiagen, 1:2000, 34610), anti-Myc (ChromoTek ...
-
bioRxiv - Biochemistry 2022Quote: ... Mouse anti-His (Qiagen, 34670; 1:200) and goat anti-mouse IgG-AF488 (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 1 μl Type-it Master Mix (Qiagen), 0.17 μM of either FAM or VIC ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... containing 1 × Master Mix (Qiagen Multiplex Kit), 0.4 μg/μL of BSA ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mL RNAProtect Bacterial Reagent (Qiagen, #76506) was added to each sample and thawed on wet ice for 10 min ...
-
bioRxiv - Genetics 2023Quote: ... 1 ul of 25 mM MgCl2 (Qiagen) and 1 ul of the primer mix (40 uM of the Forward primer ...
-
bioRxiv - Genomics 2022Quote: ... 400 nL of protease mix (6 μg protease (Qiagen, 19155), 6.25x NEBuffer 4 (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... 6 and 9 employing the RNeasy plant mini kit (Qiagen). RNA was quantified using Nanodrop (Thermo Fisher ...
-
bioRxiv - Cell Biology 2023Quote: ... For MUS81 interference it was used FlexiTube HsMUS81 6 (Qiagen). SMARCAL1 was depleted using the MISSION esiRNA HUMAN SMARCAL1 (Sigma-Aldrich) ...
-
bioRxiv - Systems Biology 2023Quote: ... 6 million PBMCs were lysed using QIAzol Lysis Reagent (Qiagen). Samples were stored at -80°C until RNA extraction ...
-
bioRxiv - Cell Biology 2023Quote: ... 6 µg C19orf43 (purified from E. coli BL21 through Qiagen Ni-TA agarose using standard procedures ...
-
bioRxiv - Biochemistry 2023Quote: ... 6 mL of Ni2+-NTA slurry (Qiagen, Venlo, LI, Netherlands) were equilibrated in a gravity flow column with Wash Buffer (50 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2023Quote: ... UniSpike 6 (included in the QIAGEN miRCURY LNA RT Kit) to verify the efficacy of reverse transcription (RT ...
-
bioRxiv - Microbiology 2020Quote: ... and a plasmid expressing VSV-G or HIVKB9 envelope glycoproteins were cotransfected at the mass ratio of 9:1 (9 Hi.fate / 1 Env) using Effectene (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... or WT-Cav-1 (1 µg) plus EphB1-Y600F-YFP (2.5 µg using Superfect transfection reagent (cat #301305, Qiagen). Media was replaced 6 h after transfection with fresh DMEM media containing 10% FBS ...
-
bioRxiv - Physiology 2020Quote: ... insulin-like growth factor 1 receptor (Igf1r) and sirtuin 1 (Sirt1) gene promoters were designed using the Pyromark Assay Deisgn 2.0 software (Qiagen). PCR and sequencing primers are provided in Supplementary Table 1 ...
-
bioRxiv - Plant Biology 2022Quote: RNA was extracted from 10-day-old whole seedlings grown on 1/2X MS media containing 1% sucrose and 0.8% agar (Plant RNeasy kit (Qiagen)) ...
-
bioRxiv - Systems Biology 2023Quote: ... x mg solid matrix were mixed with five times the μl amount of ACN:water (1:1, v/v) and homogenised with a TissueLyser II (30 Hz, 10 min; Retsch Qiagen). After a short centrifugation (2 min ...
-
bioRxiv - Microbiology 2021Quote: ... transferred to the laboratory (within 2 hours) on ice and immediately processed for DNA extraction using the DNeasy PowerSoil kit (Qiagen, Valencia, CA, USA) according to manufacturer protocols ...
-
bioRxiv - Cancer Biology 2019Quote: ... First-strand cDNA was prepared from 2 µg of cellular RNA in a total reaction volume of 20 µL using the reverse transcriptase Omniscript (QIAGEN, Mississauga, ON, Canada). After reverse transcription ...
-
bioRxiv - Microbiology 2021Quote: Cellular total RNA was prepared from 2-4×106 cells for each sample using the RNeasy Plus Micro kit (Qiagen, Hilden Germany, #74034). For qRT-pCR ...
-
bioRxiv - Microbiology 2021Quote: ... were selected with a P<0.05 and 2-fold change in gene expression and used for network/pathway analysis using Ingenuity Pathway Analysis (IPA; Qiagen, Valencia, CA, USA) as described previously (5).
-
bioRxiv - Genetics 2020Quote: ... approximately 30 seeds per genotype were placed in a 2 mL Eppendorf Safe Lock tube along with one stainless steel bead (Qiagen Cat. No. 69989), frozen in liquid nitrogen ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Microsatellites were co-amplified in multiplex PCR (Table 2) with a Thermocycler T Gradient machine (Biometra, Goettingen, Germany) using the Qiagen® Multiplex PCR Kit (Qiagen, Hilden, Germany). Forward primers were 5’-labeled with fluorescent dyes HEX ...