Labshake search
Citations for Qiagen :
1251 - 1300 of 3601 citations for 6 Bromo N tert butyl 2 4 chlorophenyl imidazo 1 2 a pyridin 3 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... 6 or 24 h using an RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: RNA interference against MUS81 was performed using FlexiTube HsMUS81 6 (Qiagen) at final concentration of 10 nM using Lullaby 48 h before to perform experiments ...
-
bioRxiv - Developmental Biology 2024Quote: ... 6×105 cells were resuspended in 600 µl RLT buffer (Qiagen) and snap frozen on dry ice for later processing ...
-
bioRxiv - Biophysics 2019Quote: ... Lysates were spun for a further 20 min at 40,000 g at 4 °C and resulting supernatants were incubated 1 hour with Ni2+-nitrilotriacetate (NTA) agarose beads (QIAGEN) at 4 °C on rotating wheel ...
-
bioRxiv - Microbiology 2019Quote: ... Cell lysates were then incubated at 4 °C for 1-1.5 hours on one ml of Ni-NTA resin (Qiagen). The resin was then loaded into columns (Biorad ...
-
bioRxiv - Physiology 2021Quote: ... 10-50 mg tissue was homogenized (1 mM EDTA and 4 mM sodiummetabisulfite, pH 7.4) using a TissueLyser II (Qiagen). Samples where adjusted to the same weight/volume percentage by adding a volume of homogenization buffer and the NA content was measured by ELISA (BA E-5200 ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysates were cleared for 30 min at 45,000 × g at 4°C and incubated with 1 ml of Ni-NTA agarose beads (Qiagen) per 1 l of expression culture for 2 h rotating at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... Lysates were clarified by centrifugation for 1 h at 4°C at 10,000 rcf before being subjected to Ni-NTA (Qiagen) affinity purification following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... 4°C) and the supernatant incubated 1 hr at 4°C with 1.5 ml packed Ni-NTA Agarose beads (Qiagen). Beads were washed with buffer H adjusted to 50 mM imidazole ...
-
bioRxiv - Microbiology 2021Quote: Recombinant-construct with N-terminal His-tag was purified through IMAC-based Ni-NTA (Qiagen). IPTG induced ...
-
bioRxiv - Neuroscience 2021Quote: ... n=10) was homogenized using the PowerGen 125 handheld homogenizer in QIAzol Lysis Reagent (Qiagen) and extracted using the RNeasy Plus Universal Mini Kit (Qiagen) ...
-
bioRxiv - Biochemistry 2021Quote: ... containing an N-terminal His-tag was removed on a Ni-NTA agarose column (Qiagen). Proteins were additionally purified through a Superdex 200 26/60 size exclusion column (Pharmacia Biotech ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS ...
-
bioRxiv - Microbiology 2023Quote: ... Cellular RNAs were instead extracted using an RNAeasy mini extraction kit (Qiagen, cat. n. 74004) and then treated as described above ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted from 3 knockout and 3 littermate control samples using the QIAGEN RNeasy Micro Kit (QIAGEN 74004) according to the manufacturers protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... 0.5 µl of diluted template cDNA (1:3, nuclease-free water) per real-time PCR reaction (10 µl – SYBR Green PCR kit, Qiagen, 204143) was used to assay specific transcript abundance (CFX96 Real-Time System ...
-
bioRxiv - Immunology 2021Quote: ... RNA was extracted from homogenized lysate containing a range of 3×103 to 1×105 cells per sample using a ll Prep DNA/RNA Mini kit (Qiagen, #80204). RNA was purified and concentrated using RNAClean XP beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2021Quote: ... 200 μL of plasma/EV suspension were mixed with 1000 μL Qiazol and 1 μL of a mix of 3 synthetic spike-in controls (Qiagen, Germany). After a 10-minute incubation at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... Approximately 30 mg of frozen tissue was placed into a 2 ml flat bottom centrifuge tube on dry ice with a 5 mm stainless steel bead (QIAGEN Germantown, MD, USA; Cat#69989) at the bottom ...
-
bioRxiv - Bioengineering 2019Quote: ... and 4 μL RNase (Qiagen, 19101) were mixed into one 1.5 microcentrifuge tube and transferred into the center of the column membrane for wetting the membrane ...
-
bioRxiv - Immunology 2019Quote: ... siNOD1 (Hs_ CARD4_ 4, SI00084483, QIAGEN), siRelA (AAGATCAATGGCTACACAGGA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μl DNase I (QIAGEN) and incubated for 1 hr at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... 4 ml of RNA-protect (Qiagen) reagent were added on 2 ml of bacterial cultures during 5 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... Oligonucleotides containing shRNA inserts were PCR-amplified with primers 5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’ and 5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ and purified with QIAquick PCR Purification Kit (Qiagen). shRNA inserts and miRE18_LT3GEPIR_Ren714 backbone (inducible via Tet-On system ...
-
bioRxiv - Microbiology 2021Quote: ... samples were thawed and homogenized with a single 3 mm Eliminase washed stainless steel ball bearing in for 3 min at 30 Hz (TissueLyser II, Qiagen) then purified by the Direct-zol RNA microprep kit (Zymo).
-
bioRxiv - Cell Biology 2021Quote: Total RNA from HGC (3 x 107 cells) and SPZEJ (3-30 x 107 cells) was extracted with the RNeasy Plus Mini Kit (Qiagen), and the purity and concentration of the extracted RNA was evaluated with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from cell pellets as previously described (61), and all six RNA samples (3 acetate, 3 DIET) were cleaned with the RNeasy Mini Kit (Qiagen) and treated with Turbo DNA-free DNase (Ambion) ...
-
bioRxiv - Plant Biology 2023Quote: ... samples were flash-frozen in liquid nitrogen immediately prior to grinding and ground using 3 mm glass beads at 30 Hz for 3 min in a TissueLyser II (Qiagen) to a fine powder ...
-
bioRxiv - Plant Biology 2023Quote: ... Arabidopsis thaliana frozen leaf tissues were weighed and ground by using two 3 mm stainless steel beads for 3 minutes at 30 Hz with frozen adapters on a TissueLyser II (Qiagen). The resulting frozen powder was dissolved in 650 µL chloroform-methanol (3:7 ...
-
bioRxiv - Neuroscience 2020Quote: ... and 6 h prior to RNA extraction with the RNeasy Minikit (Qiagen). Equal amounts were reverse transcribed via the QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Neuroscience 2021Quote: ... 30s at 60°C on the Rotor-Gene Q 6-plex (QIAGEN). Mitochondrial copy number was calculated using the equation 2 × 2ΔCt ...
-
bioRxiv - Cell Biology 2022Quote: ... and 6×His-Flag-Ub was conducted using Ni-NTA agarose (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 6 and 8 dpi using Qiazol and the RNeasy mini kit (Qiagen). Purified RNAs were processed using Turbo DNase (Ambion DNAfree kit) ...
-
bioRxiv - Genetics 2023Quote: ... for 6 hours before RNA extraction using the RNeasy Mini kit (Qiagen). Complementary DNA (cDNA ...
-
bioRxiv - Plant Biology 2021Quote: ... The translation mixture was gently agitated in a microtube for 1 h at 4°C with a fivefold volume of Ni-NTA agarose (Qiagen) that had been equilibrated with a solution containing 50 mM Tris-HCl (pH 7.5 ...
-
bioRxiv - Genetics 2022Quote: ... The tissue powder was then transferred to a 1.5 mL centrifuge tube where 400 μL of 1% PVP-40 Buffer AP1 solution and 4 μL of RNase A were added (Qiagen DNeasy Plant Kit Qiagen Inc ...
-
bioRxiv - Cancer Biology 2019Quote: ... Tumors were homogenized with QIAGEN Tissue Lyser (4 × 1’, 30 Hz) using a 5mm stainless steel bead (Qiagen, Hombrechtikon, Switzerland) and sonicated for 20s ...
-
bioRxiv - Plant Biology 2020Quote: ... After vortexing the samples for 10 s and lysing the tissue with 4 mm glass beads for 1 min at 30 Hz in the TissueLyser II (Qiagen), 400 μL of Tris-HCl pH:7.5 were added and the samples were again mixed for 1 min in the TissueLyser ...
-
bioRxiv - Immunology 2020Quote: RNA was extracted from isolated neutrophils after the 1 and 4 hour EC challenges as well untreated controls using the miRNeasy Micro kit from Qiagen and libraries were generated using KAPA PolyA enrichment mRNA library prep ...
-
bioRxiv - Genomics 2021Quote: ... To eliminate lipids supernatants were applied to a RNeasy column and centrifuged at 10,000 rpm and 4 °C for 1 min (Qiagen, 74104). The flow through was collected and protein concentrations were assessed using the Bradford assay ...
-
bioRxiv - Neuroscience 2021Quote: ... and 0.4 mg/mL Proteinase K (55°C for 1 hour) before being purified using the QIAquick PCR purification kit (QIAGEN). qPCR was performed on the Rotor-Gene 3000 (Corbett Life Science ...
-
bioRxiv - Biophysics 2022Quote: ... The resulting mixture was rotated at 4 °C for 60 min and then poured into a 1 mL polypropylene column (Qiagen). The resin was washed three times with 5 mL lysis/wash buffer and eluted in 0.25 mL fractions with Ni-NTA elution buffer (composition same as lysis/wash buffer ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria are harvested by centrifugation (5 minutes, 4°C) and washed with 1 ml cold PBS containing RNA stabilization reagents (RNAprotect, Qiagen) before flash freezing and storage at -80°C ...
-
bioRxiv - Biochemistry 2024Quote: ... The cell pellet was removed after centrifugation (16000 rpm, 4 °C, 1 h) and supernatant was loaded into a Ni-NTA agarose column (Qiagen). Protein was eluted in an elution buffer (50 mM Tris-HCl ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... previously coated with the anti-B55δ antibody (1 hour incubation at 4°C, followed by extensive washes) and Nickel beads (Qiagen) coated with 400 μg of 6XHIS-S67thio-S109A-XeARPP19 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Prior to RNA extraction individuals were homogenized in 200 μl homogenization buffer including 4 μl 1-Thioglycerol using a TissueLyser II (Qiagen) with a mixture of five 1 mm zirconia (BioSpec Products ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 3 ml RNAprotect Bacteria Reagent (Qiagen), divided into 3 × 1 ml aliquots (3 technical replicates) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3) QIAamp DNA Stool Mini Kit (QIAGEN®) and 4 ...
-
bioRxiv - Microbiology 2024Quote: ... The 3 PCR amplicons were gel purified (Qiagen), added in equimolar quantities ...
-
bioRxiv - Physiology 2023Quote: ... Arf6 siRNA sequence: 5’- CAACGTGGAGACGGTGACTTA-3’ (QIAGEN SI02757286). QIAGEN All Stars Negative sequence was used as control.