Labshake search
Citations for Qiagen :
1201 - 1250 of 1275 citations for 5 tert butoxy 5 oxopentanoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding the recombinant full-length Spike protein and the RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). ELISA plates (Immulon 4 HBX ...
-
bioRxiv - Biophysics 2022Quote: ... Supernatants were incubated with glutathione Sepharose (GSH) fast flow beads (GE-Healthcare) for GST-tagged proteins or nickel– nitriloacetic acid (Ni-NTA) agarose (Qiagen) for His-tagged proteins for 2 h at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: Total viral RNA was extracted from deactivated samples using automated nucleic acid extraction on the QIAsymphony and the DSP Virus/Pathogen Mini Kit (QIAGEN). One step reverse transcription to cDNA and real-time PCR (RT-PCR ...
-
bioRxiv - Developmental Biology 2019Quote: A locked nucleic acid (LNA) oligonucleotide probe antisense for the mature form of miR-92a-3p was designed and produced by Qiagen. The probe sequence was ACAGGCCGGGACAAGTGCAATA ...
-
bioRxiv - Biochemistry 2019Quote: ... and the lysate was mixed gently with 4 ml (50% slurry) of nickel-nitrilotriacetic acid (Ni-NTA)-agarose resin (Qiagen) at 4°C for 1 h ...
-
bioRxiv - Plant Biology 2019Quote: ... Supernatant was applied twice to a column containing a gel bed of 2 ml nickel-nitriloacetic acid agarose (Qiagen, www.quiagen.com) equilibrated with lysis buffer ...
-
bioRxiv - Cancer Biology 2020Quote: ... we utilized 4 mL of plasma and cfDNA was isolated using the QIAamp Circulating Nucleic Acid Kit (Qiagen, Hilden, Germany). The concentration of cfDNA was determined using the Qubit dsDNA High Sensitivity Assay Kit (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... Nucleic acids were purified from the lysates using the Qiagen AllPrep DNA/RNA mini kit (Qiagen Inc., Valencia, CA, USA), quantified using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... Purification of p53-(1-73) from the clarified cell lysate was accomplished using a Nickel Nitrilotriacetic Acid (Ni-NTA, Qiagen) column purification and 50 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: His-FlhAC and His-FlgN were purified by Ni affinity chromatography with a nickel-nitriloacetic acid (Ni-NTA) agarose column (QIAGEN) as described previously12 ...
-
bioRxiv - Neuroscience 2019Quote: ... PCR reactions were performed using the miRCURY LNA SYBR Green PCR Kit and the following locked nucleic acid (LNA) SYBR green primers from Qiagen: mmu-miR-598-3p ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA was isolated by extraction with hot acid phenol essentially as described in (67) and purified using an RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... using Qiagen DNA Blood and Tissue Mini kit on a QIAcube automated nucleic acid extraction system following manufacture’s protocol (Qiagen, MD). The nine whole-genome resequencing samples were extracted from ear pinna by mincing the tissue and incubating it overnight in 200 ug/ml Proteinase K at 55 °C with gentle shaking ...
-
bioRxiv - Physiology 2021Quote: ... We infected Sf9 cells with the recombinant virus to express and purify the His-tagged proteins using a nickel-nitrilotriacetic acid (Ni-NTA, Qiagen) column ...
-
bioRxiv - Biochemistry 2021Quote: ... The soluble extracts were applied to 2-ml columns of nickel-nitrilotriacetic acid- agarose (Ni-NTA) (QIAGEN catalog no. 30210) that had been equilibrated with lysis buffer without protease inhibitors ...
-
bioRxiv - Immunology 2021Quote: ... Plasmids encoding the recombinant full-length Spike protein and the RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). ELISA plates (Immulon 4 HBX ...
-
bioRxiv - Neuroscience 2021Quote: Fluorophore TYE665 labeled locked nuclear acid (LNA) (C4G2)6 and (CCG)8 probes (Supplemental table 2) were synthesized by Qiagen. The FISH protocol was adapted from (DeJesus-Hernandez et al ...
-
bioRxiv - Microbiology 2021Quote: ... as well as the relative amino acid content of SLPMh were calculated using the CLC Main Workbench 20.0.1 (QIAGEN, Aarhus, Denmark). Conserved domains in the amino acid sequence of SLPMh were identified based on hidden markov models via the HHPred server (Söding et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... which was done by hot acid phenol-chloroform treatment and further purified using RNeasy Mini Kit (Qiagen, Hilden, Germany, 74104). RNA stability was determined by agarose gel electrophoresis in 0.8% agarose Tris-Borato-EDTA (TBE ...
-
bioRxiv - Biophysics 2020Quote: ... 45 min at 4 °C) and supernatant containing His-tagged proteins were purified by nickel-nitrilotriacetic acid (Ni-NTA) purification (Qiagen). Protein was eluted in a final elution buffer of 20 mM Tris pH 8.0 ...
-
bioRxiv - Genomics 2023Quote: Frozen pancreas tissue was homogenized using a motorized pestle prior to conducting nucleic acid extraction using the Qiagen AllPrep Universal kit (Qiagen). The processing of all samples was randomized to minimize batch effects attributed to age or sex ...
-
bioRxiv - Microbiology 2023Quote: ... viral nucleic acids were extracted using the QIAamp Viral RNA Mini Kit (QIAGEN GmbH, QIAGEN Strasse 1, 40724 Hilden, Germany), which purifies RNA and DNA ...
-
bioRxiv - Microbiology 2023Quote: ... The cleared lysate was applied to an affinity chromatog-raphy column containing Ni-nitrilotriacetic acid (NTA) su-perflow resin (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The protein was purified under denaturing conditions by nickel-nitrilotriacetic acid (NTA)-agarose affinity chromatography as described by the manufacturer (Qiagen). A polyclonal rabbit antiserum was raised by Labcorp Early Development Laboratories Inc ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding the recombinant RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). On Day 0 ...
-
bioRxiv - Genomics 2023Quote: ... Samples were clarified by centrifugation at 2,000 rpm for 10 minutes and subjected to nucleic acid extraction using the cador Pathogen 96 QIAcube HT Kit (Qiagen) in a QIAcube HT automated extractor (Qiagen).
-
bioRxiv - Neuroscience 2023Quote: ... primary hippocampal neurons were transfected in duplicates or triplicates using 150ng of a plasmid carrying enhanced GFP-gene in combination with 5nmol Power Lock-Nucleic Acid inhibitors (Qiagen) against miR-218-5p ...
-
bioRxiv - Cancer Biology 2023Quote: ... Patient cell-free DNA was extracted from 1ml-1.2ml of patient plasma using the QIAamp Circulating Nucleic Acid Kit (QIAGEN # 55114) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Soluble protein was purified using immobilized-metal affinity chromatography (IMAC) by application of the cleared supernatant to nickel-nitrilotriacetic acid (NTA) beads (Qiagen) in a gravity flow column (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... equal amounts (200 µl) of FruK and Cra cell lysates were mixed with 100 µl of nickel-nitrilotriacetic acid beads (Qiagen). After overnight incubation at 4°C with gentle rotation ...
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant protein was partially purified by affinity chromatography on nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Qiagen, http://www.qiagen.com). Purification steps were carried out as per the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... The soluble extracts were applied to 2 ml columns of nickel-nitrilotriacetic acid agarose (Ni-NTA) (QIAGEN catalogue no. 30210) that had been equilibrated with lysis buffer ...
-
bioRxiv - Microbiology 2024Quote: Nucleic acid (NA) extraction was performed in 190 µl from each sample using the QIAamp MinElute Virus Spin Kit (Qiagen). Prior to NA extraction samples were subjected to an enzymatic cocktail treatment composed of 10X DNase 1 buffer ...
-
bioRxiv - Microbiology 2024Quote: ... The filtrate was transferred to ultra-clean 2 mL tubes and 280 µL were collected for nucleic acid extraction using the QIAamp Viral RNA mini kit (Qiagen). The extract was eluted in a final volume of 40 µL and stored at -80 °C.
-
bioRxiv - Microbiology 2024Quote: ... The protein was purified under denaturing conditions by nickel-nitrilotriacetic acid (NTA)-agarose affinity chromatography as described by the manufacturer (Qiagen). A polyclonal rabbit antiserum was raised by Labcorp Early Development Laboratories Inc.
-
bioRxiv - Biophysics 2021Quote: ... The supernatant containing solubilized protein was filtered using a 0.22 μM nylon membrane filter and incubated with 2 ml of nickel-nitrilotriacetic acid (Ni-NTA) resin (Qiagen, Germantown, MD) at 4°C ...
-
bioRxiv - Genomics 2022Quote: ... Nucleic acids (DNA/RNA) were isolated from flash-frozen tissues using the All Prep DNA/RNA Mini Kit (Qiagen, Germantown, MD) as previously described [127–129] ...
-
bioRxiv - Neuroscience 2019Quote: RNA was isolated from vehicle- or bile acid-treated microglia and astrocyte cultures using RNeasy Plus Mini Kit (Qiagen, Hilden, Germany). First-strand cDNA was synthesized by reverse transcription using the iScript cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Neuroscience 2021Quote: ... double-digoxigenin locked nucleic acid probe (RNO-MIR-124-3P: CATTCACCGCGTGCCTTA, Tm: 84°C, 339111 YD00614870-BGC, miRCURY LNA™ miRNA Detection Probe, Qiagen) was used at a final concentration of 30 nM ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were washed twice in PBS and incubated for 20 min at 54 °C (60 min at 52 °C for tissue sections) in mercury locked-nucleid acid (LNA) miRNA ISH Buffer 80 nM hybridiziation buffer (100 nM for tissue section) (Qiagen, 339450). Digoxigenin labeled miRCURY LNA probes (HSA-MIR-10B-5P ...
-
bioRxiv - Microbiology 2021Quote: Samples were homogenized and nucleic acids were extracted using the MoBio RNA PowerSoil® Total RNA Isolation Kit (Qiagen, CA, USA) and the MoBio RNA PowerSoil® DNA Elution Accessory Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2020Quote: Frozen tissues were weighed and homogenized in RLT and nucleic acids were extracted using the AllPrep DNA/RNA Mini Kit (QIAGEN, #80204) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Total RNA was isolated using the RecoverAll Total Nucleic Acid Isolation Kit (Thermo #AM1975) and concentrated using the RNeasy MinElute Cleanup Kit (Qiagen #74204). Library preparation and sequencing were performed by the Genome Sequencing Facility at St ...
-
bioRxiv - Molecular Biology 2020Quote: ... The supernatant was divided into two parts: one part was directly combined with nickel-nitrilotriacetic acid (Ni-NTA) affinity resin (Qiagen, China); the other part was heated in a 65 °C water bath for 60 minutes and then centrifuged at 14000 rpm for 60 minutes ...
-
bioRxiv - Immunology 2021Quote: ... The plasmid was transfected to 293T cells and the recombinant S protein trimers were purified by Ni-NTA (nickel-nitrilotriacetic acid) chromatography (QIAGEN, Germany), followed by size exclusion to further purify the trimers ...
-
bioRxiv - Microbiology 2022Quote: ... nucleic acid extractions were performed by combining equal amounts of cell culture supernatants with RLT Lysis Buffer (Qiagen, Germantown, MA, USA), with 200 µL of the lysate used for magnetic bead-based extraction according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was adjusted to 500 mM NaCl and 20 mM imidazole before affinity purification by incubation with nickel-nitrilotriacetic acid (Ni-NTA) resin (Qiagen, 30210) for 90 min at 4 °C ...
-
bioRxiv - Biochemistry 2022Quote: Lysates of His-tagged α-catenin WT and Δmod were bound to Ni-NTA (Ni2+-nitrilotriacetic acid)-sepharose affinity chromatography (Qiagen), washed with 50 mM Tris pH 7.8 ...
-
Macrodomain Mac1 of SARS-CoV-2 Nonstructural Protein 3 Hydrolyzes Diverse ADP-ribosylated SubstratesbioRxiv - Biochemistry 2023Quote: ... Frozen cells were thawed on ice and used for protein purification with nickel-nitrilotriacetic acid (Ni-NTA) Fast Start column as recommended by the manufacturer (Qiagen, Germany). The bound proteins were eluted from the column with elution buffer containing 50 mM NaH2PO4 ...
-
First complete genome characterization of an Indian pigeon pox virus directly from a clinical samplebioRxiv - Evolutionary Biology 2023Quote: ... The extraction of nucleic acid from infected scab samples was performed by using DNeasy blood and tissue purification Kits (QIAGEN, USA) with some modification established by Sarker et al. ...