Labshake search
Citations for Qiagen :
1201 - 1250 of 2946 citations for 3 2 5 Dioxoimidazolidin 4 yl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... root or shoot tissues were ground in 2 mL tubes (Qiagen) containing 3 chrome steel beads of 3.2 mm diameter (BioSpec Products ...
-
bioRxiv - Microbiology 2024Quote: ... for 2 hours and purified using QIAquick PCR Purification Kit (Qiagen). Guide RNA sequence was ordered as oligos (Tm = 51°C ...
-
bioRxiv - Microbiology 2024Quote: ... cells were treated with 2× volume of RNAprotect Bacteria Reagent (QIAGEN) for 10 min at room temperature and collected as pellets by centrifugating for 10 min at 5,000×g ...
-
bioRxiv - Genomics 2024Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Genomics 2024Quote: ... 2 ml of RNAprotect® Bacteria Reagent (cat # 76506, Qiagen Inc.) was added ...
-
bioRxiv - Genomics 2020Quote: ... The primer used in the 3’ RACE assay was designed using CLC Genomic Workbench (ver. 10.1.1, Qiagen) near the highest CAGE-Seq signal in the determined TSS region ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 3 mL were collected and used for plasmid extraction using a QI-Aprep Spin Miniprep kit (QIAGEN). Extracted plasmids were eluted in 30 μL of elution buffer and stored at −20 °C until use.
-
bioRxiv - Cancer Biology 2021Quote: Whole RNA (1-3 μg total per 10 μL volume) was isolated using RNAeasy mini kit (QIAGEN) or TRIzol (Life Technologies ...
-
bioRxiv - Bioengineering 2022Quote: Total RNA content was extracted from 3 biological replicates using RNeasy® Plus Mini kit (#74134, Qiagen) following manufacture’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Pelleted cells were resuspended in 1 ml of Na2CO3 buffer containing 3 µg/ml RNase A (Qiagen) and incubated at 50°C for at least 4 h ...
-
bioRxiv - Microbiology 2022Quote: Extraction method 3 used a modified version of the Qiagen QIAamp Mini DNA kit (Qiagen, Venlo, Netherlands). Following initial pelleting ...
-
bioRxiv - Microbiology 2022Quote: ... 1ml of PBS-AB was added to each sample along with Tungsten carbide 3 mm beads (Qiagen). Samples were homogenized for 10 min and then centrifuged at 15,000 g for 10 min ...
-
bioRxiv - Immunology 2021Quote: ... The samples (N=3) were collected immediately and soaked in 10 volumes of RNAlater (Qiagen, Hilden, Germany), for sequencing using Illumina (New England Biolabs) ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then washed 3 x with ice-cold 1x PBS and lysed in RLT buffer (Qiagen) with 1/100 β-mercaptoethanol (Sigma ...
-
bioRxiv - Genetics 2021Quote: Genomic DNA was extracted from an aliquot of 3 × 106 cells using the Gentra Purgene Kit (Qiagen). The genomic region surrounding the CRISPR/Cas9 target site (741 bp ...
-
bioRxiv - Cancer Biology 2023Quote: Small interfering RNA was obtained to knockdown the expression of ARSB and galectin-3 (Qiagen, Germantown, MD). Effects on mRNA were determined by QRT-PCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA (>200nt) was extracted from 400 testes of ≤3 days old flies using miRNeasy Mini column (QIAGEN). For the first replicate ...
-
bioRxiv - Microbiology 2024Quote: ... MRU2687-3 and ZH548 viral stocks were extracted using the QIAmp Viral RNA kit (Qiagen; Courtaboeuf, France) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant from the second spin was incubated with 3 mL of Ni-NTA agarose beads (Qiagen) for 30 minutes at 4°C in the cold room ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA from patient material (n=3) and organoids (xxx) was extracted (RNeasy™ Mini Kit, Qiagen). To obtain cDNA ...
-
bioRxiv - Bioengineering 2022Quote: ... messenger RNA (mRNA) combined from at least 3 gels were isolated with an RNeasy Mini Kit (Qiagen) and then reverse transcribed into complementary DNA (cDNA ...
-
bioRxiv - Immunology 2022Quote: ... DNA was extracted from frozen cell pellets (3×107 cells; Blood & Cell Culture DNA Maxi Kit, Qiagen) per manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: Total RNA was extracted (n=3) from the frozen endosperm tissue using the RNeasy PowerPlant kit (Qiagen). An on-column DNase digest was incorporated during the extraction ...
-
bioRxiv - Immunology 2024Quote: ... we transfected the 293T cells at 3 million cells/10 cm dish with Effectene transfection reagent (Qiagen) following manufacturer guidelines ...
-
bioRxiv - Cell Biology 2024Quote: ... Tissues were homogenized for five 3-minute cycles of 30 shakes/sec using a TissueLyser II (Qiagen) and transferred to an RNase free microfuge tube (Ambion ...
-
bioRxiv - Cancer Biology 2024Quote: The FASTQ file was analyzed by QIAseq UPX 3’ Transcriptome Primary Quantification tool (QIAGEN GeneGlobe analysis website) to generate gene expression matrix ...
-
bioRxiv - Cell Biology 2024Quote: ... RNase-A was degraded by the addition of proteinase-K (3 mAU/mL, 19131, Qiagen, Hilden, Germany) and inverting the tube briefly ...
-
bioRxiv - Microbiology 2021Quote: ... was modified by a custom-added biotin residue at its 5’-end (Qiagen). Hybrids of the CoV-2 RNAs with the probe were detected with a goat anti-biotin antibody conjugated to 10 nm gold particles (BBI international).
-
bioRxiv - Cell Biology 2020Quote: ... mRNA samples were concentrated to ≤ 5 µl by MinElute column (QIAGEN, Cat. 74204). For generation of RNA-seq libraries ...
-
bioRxiv - Immunology 2021Quote: RNA was isolated from ~5 x 105 cells using RNeasy mini kits (Qiagen), typically yielding 100-400 ng RNA ...
-
bioRxiv - Plant Biology 2021Quote: ... Samples were homogenized using 5 mm steel beads and a Tissuelyser II (Qiagen) operated at 30 Hz for 5 min ...
-
bioRxiv - Immunology 2020Quote: ... 5 U/ml dispase (Stemcell) and 50 mg/ml DNase I mix (Qiagen) in complete RPMI1640 medium ...
-
bioRxiv - Molecular Biology 2021Quote: ... genomic DNA was isolated from 5 million cells using the DNAeasy kit (Qiagen). 4ug gDNA was digested with NlaIII or MseI ...
-
bioRxiv - Cell Biology 2020Quote: ... 20 μl of 10% SDS and 5 ul of Proteinase K (Qiagen #19131) were added to each sample ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 10x CoralLoad PCR buffer and 5 µl of TopTaq Master Mix 2x (Qiagen). An initial denaturation cycle of 94°C for 6 min was followed by 35 cycles of 94°C for 45 s ...