Labshake search
Citations for Qiagen :
1151 - 1200 of 1365 citations for 7 METHOXY 1H QUINOLIN 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: Assessment of differential expression was conducted on the mapped reads of the 2 previously mentioned pipelines using 2 methods for comparison: the EDGE method with default settings in CLC Genomics Workbench 12 (QIAGEN) and EdgeR (version 3.34.0) ...
-
bioRxiv - Neuroscience 2022Quote: ... Pathway analysis was performed for genes 2-fold up- or down-regulated with p-value < 0.05 using Ingenuity Pathway Analysis (IPA) software (Qiagen, USA).
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 RNA from cell culture supernatant samples was isolated using AVL buffer and the QIAamp Viral RNA Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... The mixture was incubated at 16°C for 2 h and the resulting double-stranded DNA was purified using the MinElute PCR Purification kit (Qiagen) with 20μl EB for elution ...
-
bioRxiv - Systems Biology 2022Quote: 2 × 109 cells pretreated with TRIzol reagent were used for preparing RNA reference materials using RNeasy Maxi kit (Qiagen, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... commercially available cDNAs originating from various human tissues were purchased from TaKaRa (detailed sample information is given in Table S3) and 2 ng of cDNA were subjected to quantitative PCR (qPCR) analysis (Rotor-Gene Q, Qiagen), as recommended by the manufacturers ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: SARS-CoV-2 RNA from cell culture supernatant samples was isolated using AVL buffer and the QIAamp Viral RNA Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: 3×106 cells from the day 8 of CD34+ HSPC and day 6 of HUDEP-2 erythroid differentiation were used for total RNA using RNeasy Mini Kit (Qiagen). For reverse transcription using Primescript RT reagent kit (Takara Bio Inc.) ...
-
bioRxiv - Immunology 2022Quote: Total RNA was prepared from 1-2*106 sorted naïve (CD25− CD44lowCD62high) or effector (CD25− CD44highCD62low) CD4+ T-cells using RNeasy Mini Kit (Qiagen Inc.) as described in manufacturer’s protocol including an on-column digestion step (RNaseFree DNase Set ...
-
bioRxiv - Pathology 2023Quote: ... DNA was extracted after routine paraffin embedding (2 sections of 20 μm per sample) from 10 canine tumors (DNeasy Blood & Tissue Kit, Cat. No.69504, Qiagen; Veterinary Science Dept ...
-
bioRxiv - Neuroscience 2023Quote: ... ATAC-seq libraries were resolved on 2% agarose gels and fragments ranging in size from 100bp-1Kbp were excised and purified (Qiagen Minelute Gel Extraction Kit – Qiagen Cat#28604) ...
-
bioRxiv - Microbiology 2023Quote: ... samples were transferred from DNA/RNA Shield – Lysis Tube to a 2 ml eppendorf and cells lysed using a TissueLyser II (Qiagen) at maximum speed (5 repetitions of 1 min with 1 min on ice between each) ...
-
bioRxiv - Biochemistry 2023Quote: ... the cell lysate was cleared by centrifugation (20L000 rpm, 30 minutes, 4 °C) and purified using Ni+2-affinity chromatography (Ni-NTA superflow cartridges, Qiagen). Typically two 5 mL columns (flow 5 mL/min ...
-
bioRxiv - Microbiology 2023Quote: ... The homogenate was treated overnight with proteinase K (2 mg/ mL) at 56 °C and DNA was extracted using the MagAttract PowerSoil DNA EP Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA and proteins were extracted from fresh or snap-frozen FACS-sorted 2-5 million splenic B cells using AllPrep DNA/RNA/Protein Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... the eluted DNA samples were run on a 2% agarose gel and the 280bp band purified using the QIAquick Gel extraction kit (QIAGEN). Illumina libraries were generated from 10 ng of DNA ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mosquito bodies and legs were homogenized in phosphate-buffered saline (PBS) supplemented with 20% FBS and 2% penicillin-streptomycin with 5-mm stainless steel beads with a TissueLyser (Qiagen) before RNA isolation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Approximately 1 μg of small RNAs in 8.5 μl were incubated with 2 μl of QIAseq FastSelect –rRNA Yeast Kit (Qiagen, #334215) at 75°C ...
-
bioRxiv - Immunology 2023Quote: Purified CD4+FYP+ Treg cells were stimulated with Cell Stimulation Cocktail (eBioscience) for 2 hrs and lysed in RLT buffer (Qiagen) containing 1% 2-mercaptoethanol (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... Crystals were grown at 30°C by the hanging drop vapor diffusion method using 2 μL sample drops and 300 μL crystallization solution in a sealed chamber (EasyXtal 15-Well Tool, Qiagen). Crystals were soaked for 1h (for the Na structure or with the dibromo Intronistat B derivative ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease40 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The supernatant was then purified using a modified PB buffer and eluted using 2 washes in 18 μl buffer EB (QIAGEN) - with 3 min of incubation time at 37°C (Dabney et al ...
-
bioRxiv - Genetics 2023Quote: ... Whole blood was collected in 2% SDS Queens lysis buffer [23] and genomic DNA was extracted using a DNeasy Blood & Tissue Kit (Qiagen). All research was approved by the Institutional Animal Care and Use Committee at Columbia University (AC-AAAW6451) ...
-
bioRxiv - Genomics 2023Quote: ... to the eluted samples and digestion was carried out for 2 hours at 55°C followed by PCR purification (Qiagen). Sequencing libraries were prepared using the NEBNext Ultra II DNA Library Preparation Kit (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... and RNAI were amplified by PCR (primer sequences are listed Supplementary Table 8) and PCR products were analysed by 2 % agarose gel electrophoresis and purified using the QIAquick PCR purification kit (QIAGEN). 5’-triphosphate (PPP ...
-
bioRxiv - Microbiology 2023Quote: RNA was isolated from 2 h and 10 h RPMI-grown and macrophage-internalized Cg cells using the RNeasy kit (Qiagen), followed by DNase I digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... gDNA wipeout buffer was used to remove Genomic DNA for 2 minutes at 42°C and cDNA was synthetized with the QuantiTect Reverse Transcription Kit (Qiagen). qPCR was performed with PowerUp SYBR Green Master Mix using the StepOnePlus Real-Time PCR system ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Genetics 2023Quote: Genomic DNA of subclones from a 12-well plate along with 2 million parental cells were extracted using DNeasy Blood & Tissue Kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Pathology 2023Quote: ... RNA from CD4+ T cells (2×106 cells per condition) was extracted by using the RNeasy Plus Mini kit (QIAGEN). Extracted total RNA was quantified using the Qubit broad range RNA assay ...
-
bioRxiv - Neuroscience 2024Quote: ... with 0.9 x tissue mass of lysis buffer (1x RIPA buffer with 2% SDS and 2x protease inhibitor cocktail) and TissueRuptor II (Qiagen) homogenization ...
-
bioRxiv - Neuroscience 2024Quote: ... 100 mg of frozen brain was taken per mouse sample and lysed with 0.9 x tissue mass of lysis buffer (1x RIPA buffer with 2% SDS and 2x protease inhibitor cocktail) and was homogenised using a TissueRuptor II (Qiagen). Zebrafish larvae were similarly extracted ...
-
bioRxiv - Molecular Biology 2023Quote: Bulk-RNA free of genomic DNA for RT-qPCR analysis was extracted from cell pellets (≤ 2 x 106 cells) using the RNeasy plus spin-column purification kit (Qiagen) and performed using the Qiacube liquid handler (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were sorted directly into 2-Mercaptoethanol-containing RLT buffer and RNA was extracted using a RNeasy Mini kit (Qiagen). The cell populations used for RNA sequencing are summarized in Table S1 ...
-
bioRxiv - Microbiology 2023Quote: ... Pellets were washed in 2 mL cold 10 mM NaCl + 4 mL cold RNAprotect Bacteria Reagent (Qiagen Cat. No. 76506) and repelletted at 4,255 x g ...
-
bioRxiv - Microbiology 2023Quote: ... preceded by a 10-minute bead-beating step at 30 Hz in 2 ml e-matrix tubes (MP Biomedical, USA) using a Tissuelyser II (Qiagen). Molarity and fragment-length distribution of the extracts were measured using a Tapestation ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tumours were harvested 2-3 weeks after transplantation and genomic DNA was extracted from tumours using the Gentra Puregene DNA Extraction kit (QIAGEN).
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was isolated from kidneys of three independent biological samples for each age (E17.5, 2 months) and genotype using an RNeasy Mini Kit (Qiagen 74104) with on-column DNAse I treatment ...
-
bioRxiv - Biophysics 2023Quote: ... The soluble extracts were applied to 2 ml columns of nickel-nitrilotriacetic acid agarose (Ni-NTA) (QIAGEN catalogue no. 30210) that had been equilibrated with lysis buffer ...
-
bioRxiv - Genomics 2023Quote: Total DNA from enhancer screening library transduced HUDEP-2 cells was isolated using the DNeasy Blood & Tissue kit (Qiagen, 69504) and the enhancer inserts were PCR amplified using the following primers:
-
bioRxiv - Plant Biology 2023Quote: ... RNA was extracted from the root tip (2 cm apex) of the primary root using the RNeasy Plant Mini Kit (QIAGEN). RNA-seq was performed by the Montpellier GenomiX Platform (MGX ...
-
bioRxiv - Plant Biology 2024Quote: ... from infected leaf material or from urediniospores of non-target rust species (Table 2) with the DNeasy Plant mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA (2 μg per sample) extracted from 1×106 BSCs was performed using the Qiagen RNA RNeasy Kit (Cat#74104, Qiagen) followed by library preparation with the Illumina TruSeq V2 Kit (Cat#20020594 ...
-
bioRxiv - Genetics 2023Quote: ... To prepare the protein column we loaded 2 mL (1 mL column volume) of Nickel NTA resin onto the 5 mL Polypropylene columns from Qiagen and the resin buffer was allowed to drain ...
-
bioRxiv - Genetics 2023Quote: ... Digests were incubated for 2 hours at 37°C then purified using a QiaQuick PCR purification kit (Qiagen Cat#28106). Fragments of 2100 bp were size-selected using a SageELF instrument (Sage Science ...
-
bioRxiv - Genetics 2023Quote: Total RNA was extracted from 2-week-old seedlings grown on an MS plate using RNeasy Plant Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... The amplicon library pools were isolated based on size by gel electrophoresis using a 2% agarose gel and then purified using QIAEX II Gel Extraction Kit (QIAGEN) and using 30uL of QIAEX II beads for each sample ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Approximately 50 mg of tissue was homogenised in 500 µl phosphate-buffered saline (PBS) for 2 min at 30 Hz using 5 mm steel beads on a TissueLyser II instrument (Qiagen). Total nucleic acids were extracted using the Nucleo Mag Vet Kit (Macherey & Nagel ...
-
bioRxiv - Genetics 2023Quote: ... The leaves were ground in liquid nitrogen and powder was resuspended in 2 ml of RLT buffer from RNeasy Plant Mini kit (Qiagen). For each sample ...