Labshake search
Citations for Qiagen :
1151 - 1200 of 1604 citations for 6 Methyl 5 propyl 4 1H pyrimidinone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Lysates were centrifuged for 30 min at 38,000 g and 4°C and cleared supernatants loaded onto Ni-NTA columns with 0.5 mL bed volume (1018244 Qiagen, Germany). The columns were washed sequentially with 3 column volumes (CV ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were selected in puromycin (1 μg/ml) the next day and after 4 days genomic DNA was extracted using DNeasy Blood and Tissue kit (Qiagen). Genomic DNA was sonicated to an average size of 500 bp using S2 Focused-ultrasonicator (Covaris ...
-
bioRxiv - Neuroscience 2023Quote: ... Amplicons were size-verified on a 4% agarose gel and PCR amplicons were extracted and purified (Qiaquick Gel Extraction Kit, Qiagen) before indexing (Nextera XT ...
-
bioRxiv - Developmental Biology 2023Quote: ... Then samples and inputs were incubated for 4 hr at 37°C with 1.5 µl of 10 mg/ml RNase A (Qiagen, 1007885) and 15 µl 10% sodium dodecyl sulfate and 3.5 µl 20 mg/ml Proteinase K (Thermo Fisher ...
-
bioRxiv - Genomics 2024Quote: ... Digested product was then run on a 4% agarose gel with 1x SYBR Safe for 45 minutes at 100 V and gel extracted (Qiagen).
-
bioRxiv - Microbiology 2023Quote: ... Sample DNA was extracted from microbiome samples using the PowerSoil DNA extraction kit (Cat. No. 12955-4, Qiagen, Valencia, California). Marker genes in isolated DNA were polymerase chain reaction (PCR)-amplified using GoTaq Master Mix (Cat ...
-
bioRxiv - Immunology 2022Quote: ... Kidneys were mechanically disrupted with metal beads during 3 min at 4°C and DNA was then extracted using QIAmp DNA kit (Qiagen). Leptospiral DNA was specifically targeted using primers and probes designed in the lpxA gene (L ...
-
bioRxiv - Cancer Biology 2022Quote: 3 Type D and 3 Type V SCLC tumor-derived cell lines were treated with either vehicle (EtOH) or 4-OHT for 3 days and RNA was isolated using the RNeasy Mini Kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: We euthanized groups of 20 to 30 zebrafish larvae by immersion in ice-cold water (below 4°C) and immediately performed RNA extraction using the RNeasy Mini Kit (Qiagen) and reverse transcription using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Passage 0 and 4 organoids were dissociated to single cell suspensions and DNA extracted using the QIAamp DNA Micro kit (Qiagen). The extracted genomic DNA was sheared and the fragments were end repaired ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA of LDOs in EM on day 4 after passage was extracted using the RNeasy Mini kit (QIAGEN, Hilden, Germany). After cDNA synthesis using the QuantiTect Rev ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCR products were separated on a 4% agarose gel at 110V for 40 min and proper-sized products extracted using QIAquick gel extraction kit (Qiagen). Following denaturation in undyed loading buffer at 95°C for 3 min ...
-
bioRxiv - Neuroscience 2023Quote: RNA was isolated from hippocampal tissues of 4- and 9-month-old WT and Tau mice using RNeasy Mini kit from Qiagen with DNase digestion ...
-
bioRxiv - Biochemistry 2023Quote: ... Filters were incubated at 55°C for approximately 4 h and the resulting lysates were purified with the DNeasy kit (Qiagen) using a slightly modified protocol49 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Prior to RNA extraction individuals were homogenized in 200 μl homogenization buffer including 4 μl 1-Thioglycerol using a TissueLyser II (Qiagen) with a mixture of five 1 mm zirconia (BioSpec Products ...
-
bioRxiv - Developmental Biology 2023Quote: ... Supernatants were separated from lysates and incubated with affinity beads at 4°C overnight (His beads: Ni-NTA from QIAGEN; GST beads ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from the hippocampus of P65 females of all four groups (n=4/group) using the RNeasy Midi Kit (Qiagen). RNA samples were submitted to the University of Minnesota Genomics Center for library preparation and sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... Template DNA was degraded using RQ1 DNAse for 30 min at 4°C and RNA was purified using RNAeasy mini kit (Qiagen). 4-week-old NRG mice were injected intra-hepatically using 10 µg of RNA in a maximum volume of 50 µL of PBS+RNA and one week post injection a terminal bleed was performed ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cell Biology 2024Quote: RNA was isolated from ciDKO podocytes (3 days after Cre lentiviral transduction) and wild-type control cells (n=4 for each group) using an RNeasy mini kit (Qiagen). RNA was quantified using a Qubit Fluorimeter (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... were immediately placed in RNAlater during dissection and stored at 4 degrees Celsius until RNA isolation using the RNeasy Mini Kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Culture supernatant containing His-tagged NTD protein was harvested 4 days after transfection and was purified using Ni-NTA resin (Qiagen). Spike protein was further purified with a Superose 6 Increase 10/300 GL column equilibrated with 20 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Molecular Biology 2024Quote: ... was reverse transcribed at 37 °C for 2 h in a 20 μL reaction volume containing 4 U of Omniscript reverse transcriptase (Qiagen), 0.5 mM each dNTP ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was eluted in 100 µL of TE-0.5% SDS buffer with Proteinase K at 60 °C for 4 hours and purified using the MiniElute PCR purification kit (Qiagen).
-
bioRxiv - Microbiology 2024Quote: DNA extraction was carried out from 300 μL culture pellets using the DNeasy UltraClean 96 Microbial Kit (Qiagen 10196-4). Subsequent library preparation and sequencing were conducted at the NGS Competence Center NCCT (Tübingen ...
-
bioRxiv - Immunology 2024Quote: Bladders were weighed and homogenized in 1 mL of sterile PBS at 4°C using a handheld rotor-stator tissue homogenizer (TissueRuptor II, Qiagen). Homogenates were serially diluted ...
-
bioRxiv - Microbiology 2024Quote: ... The cell lysates were centrifuged at 10000 g for 30 min at 4 °C and the clear supernatant was collected and passed through Ni-NTA agarose column (Qiagen). Contaminating proteins were washed away by passing a 20–120 mM imidazole gradient through the column while the bound toxins were eluted using PBS containing 500 mM imidazole ...
-
bioRxiv - Physiology 2024Quote: ... RNA was isolated from pooled vessels (4 renal arteries or 2 mesenteric arteries) using the RNeasy Micro kit (Qiagen, USA), quantified by the NanoDrop-1000 (Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Digoxigenin (DIG)-labelled probes were denatured at 90°C for 4 min and diluted with 1 x microRNA ISH buffer (Qiagen), following protocol by Endisha & Kapoor ...
-
bioRxiv - Biophysics 2024Quote: ... and then spun down 4 ml of the culture before proceeding to isolation of the final plasmid using a QIAprep Spin Miniprep kit (Qiagen). The samples were stored at 4 °C ...
-
bioRxiv - Genomics 2024Quote: Ten aphids (n = 10 × 4) were ground to powder with a liquid nitrogen-cooled micropestle after which the RNeasy kit (Qiagen) was used for RNA extraction with on-column DNA digestion (Qiagen) ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted from 5,000 sorted melanocytes from 3-4 control or ID1-overexpressing fish per stage using RNeasy Micro Kit (Qiagen, 74004). Ultralow input RNA-seq was performed using the SMART-Seq v4 Ultra Low Input RNA kit for Sequencing (Clontech ...
-
bioRxiv - Biochemistry 2024Quote: ... The lysate was then cleared by centrifugation at 42,000 ξ g for 50 min at 4°C before being applied to 2 mL of Ni-NTA resin (QIAGEN) in a gravity flow column ...
-
bioRxiv - Developmental Biology 2021Quote: ... Luciferase reporter constructs were either mock-treated or methylated in vitro with SssI CpG methyltransferase for 4 h at 37 °C and purified with the QIAquick Purification Kit (QIAGEN 28704). Reporter plasmid (500 ng ...
-
bioRxiv - Physiology 2020Quote: ... RNA was isolated from maternal and fetal tissues (Table 3 and 4) using QIAamp cador pathogen mini kit (Qiagen, Valencia, CA). ZIKV RNA was quantitated by one-step quantitative real time reverse transcription PCR using QuantiTect probe RT-PCR kit (Qiagen ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... was ground to small pieces by one steel ball (Ø 4 mm) in a 2 ml Eppendorf tube with Tissue Lyzer II (Qiagen, Hilden ...
-
bioRxiv - Biochemistry 2020Quote: ... 4°C) an applied to a 2 ml Ni-NTA immobilised metal affinity chromatography (IMAC) gravity flow column (QIAGEN, Hilden, Germany). Columns were washed in 10 column volumes (CV ...
-
bioRxiv - Molecular Biology 2021Quote: ... the PCR products were held at 4°C until PCR purification using the QIAquick PCR purification kit (#28106, Qiagen, Hilden, Germany). DNA concentrations were determined using NanoDrop 2000 (Thermo Scientific) ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from 150 mg of cluster roots (3 to 4 roots) using the RNeasy Plant Mini Kit (Qiagen, 74904) and treated with the DNA-free DNA Removal Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... 100μL chloroform were added and samples spun at 7000rpm for 15min at +4°C in a MaXtract column (Qiagen, Venlo, Netherlands). Mixed with 500μL 70% EtOH and spun at 10 000rpm for 30s at +4°C in a MiniElute column ...
-
bioRxiv - Genomics 2022Quote: ... Day 145) for n=4 clams for each treatment (Figure 2) using the Qiagen DNeasy Blood and Tissue Kit (Qiagen USA) according to manufacturer’s instructions with slight modifications ...
-
bioRxiv - Neuroscience 2022Quote: At DIV 28-30 iPSC-MG from 8 C9orf72 ALS/FTD patient lines and 4 control lines were pelleted and lysed using QIAshredder (QIAGEN-79654) and RNA was isolated with RNeasy Mini Kit (QIAGEN-74104 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and ∼55 mg of total protein in CFE was incubated for 60 min at 4 °C with 2 mL of Ni-NTA agarose (QIAGEN, Germany) equilibrated with purification buffer A ...
-
bioRxiv - Immunology 2020Quote: ... Pellets were lysed by vortexing for 1 minute in 350uL cold supplemented RLT buffer (RLT + β-MeOH) at 4°C and lysates homogenized using QIAshredder columns (Qiagen). RNA was then extracted from these samples using the RNeasy Plus Micro kit (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: ... The coverslips were then incubated for ~ 10 min with 4 μg/ml of Penta•His biotin conjugate antibody (34440, Qiagen, UK) in reaction buffer [40 mM HEPES buffer (pH 7.3 ...
-
bioRxiv - Genomics 2022Quote: ... 4°C) and stored at −80°C before metagenomic extraction using the DNeasy PowerSoil kit following manufacturer specifications (QIAGEN, Hilden, Germany). All sampling and sample processing was conducted following cold chain principles ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA was extracted from MCF10AER/vSrc cells (Control and treated with 10 nM D-Alanine for 4 h or 24 h) using RNeasy Kit (Qiagen, #74104) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was extracted from patient tissue samples and flash frozen mouse xenograft tumor samples (n = 4) using the RNeasy kit (Qiagen; #74104) and converted to cDNA using the qScript cDNA Synthesis kit (Quantabio ...
-
bioRxiv - Biophysics 2023Quote: ... dCas9-Halo protein was purified from the supernatant by incubating for 2 h at 4 °C with Ni-NTA agarose (Qiagen #30210). The beads were washed 10 times with 5 ml dCas9 wash buffer I (50 mM NaxPO4 pH 7.0 and 300 mM NaCl ...
-
bioRxiv - Biophysics 2023Quote: ... dCas9-Cys protein was purified from the supernatant by incubating for 2 h at 4 °C with Ni-NTA agarose (Qiagen #30210). The beads were washed 10 times with 5 ml dCas9-Cys wash buffer (20 mM Tris-HCl pH 8.0 ...