Labshake search
Citations for Qiagen :
1101 - 1150 of 10000+ citations for TBARS MDA Universal Colorimetric Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... DNeasy Blood & Tissue Kit and QIAamp DNA FFPE Tissue Kit (Qiagen) were used for Genomic DNA extraction of paired FF and FFPE samples respectively.
-
bioRxiv - Genomics 2021Quote: ... These kits included QIAamp Circulating Nucleic Acid Kit (Qiagen, Hilden, Germany), Plasma/Serum Cell-Free Circulating DNA Purification Mini Kit (Norgen Biotek ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Plasmid Midiprep kit and Maxi kit were from QIAGEN (Valencia, CA). The 1,4-dioxane ...
-
bioRxiv - Neuroscience 2023Quote: ... The cDNA was synthesized using the KIT Quantitec Transcription KIT (QIAGEN) as recommended by the manufacturer ...
-
bioRxiv - Genetics 2023Quote: Genomic DNA was extracted with kits from QIAGEN (MagAttract HMW kit) and MACHEREY-NAGEL (Nucleospin Tissue Kit) ...
-
bioRxiv - Microbiology 2024Quote: ... according to kit instructions (REPLI-g single cell kit, #150345, QIAGEN). Sequencing libraries (PE150 ...
-
bioRxiv - Bioengineering 2024Quote: ... RNA extraction kit and reverse transcription kit was obtained from Qiagen.
-
bioRxiv - Neuroscience 2019Quote: ... Only the neocortical primordium and the commissural plate were dissected and stored in RNA Later (Qiagen) at −20°C until RNA extraction ...
-
bioRxiv - Systems Biology 2020Quote: ... Each well in the NAB plate was then washed once with 500 uL Buffer AW1 (QIAGEN) and once with 500 μL of Buffer AW2 (QIAGEN) ...
-
bioRxiv - Developmental Biology 2024Quote: mESCs were plated on gelatin-coated plates in N2B27-2i and transfected with FlexiTube siRNAs (Qiagen) using DharmaFECT 1 (Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... and placed in a well of 96-well plate containing 2,5µl of RLT plus buffer (Qiagen). At the end of cell collection ...
-
bioRxiv - Systems Biology 2023Quote: ... Each well in the NAB plate was then washed once with 500 μL buffer AW1 (QIAGEN) and once with 500 μL of buffer AW2 (QIAGEN) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Sodium bisulfite treatment was carried out using commercially available bisulfite conversion kits (EpiTect Fast Bisulfite Kit and EpiTect Fast LyseAll Bisulfite Kit; Qiagen) according to the manufacturer’s instructions except for the DNA denaturation step and sodium bisulfite reaction time ...
-
bioRxiv - Microbiology 2024Quote: ... and the genomic DNA/RNA extractions were conducted using commercial extraction kits (DNeasy Blood & Tissue Kit for DNA or RNeasy Mini Kit for RNA, both from Qiagen) and purified with GeneJET Genomic DNA Purification Kit (Thermo Scientific ...
-
bioRxiv - Immunology 2020Quote: ... total RNA was isolated using RNeasy Mini Kit or Micro Kit (Qiagen). Reverse transcription was performed using M-MLV Reverse Transcriptase and random primers following manufacturer’s instructions (Thermo Fisher Scientific) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... RNA was extracted using a commercial kit (RNseasy Plant Mini Kit, Qiagen), followed by cDNA synthesis (iSCRIPT ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using standard column-based purification kit (QIAGEN RNeasy Kit, Cat. No. 74004). DNase treatment was applied during the purification to remove any potential DNA contamination ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was extracted using the RNeasy Mini Kit extraction kit (QIAGEN). RNA-less and reverse transcriptase-less reactions were used as controls ...
-
bioRxiv - Cancer Biology 2021Quote: ... purified with QIAquick Gel Extraction kit or QIAquick PCR Purification kit (Qiagen), ligated using T4 DNA Ligase (New England BioLabs) ...
-
bioRxiv - Genetics 2020Quote: ... Plasmids were prepared using silica-membrane based kit (Plasmid Miniprep Kit, Qiagen) following the manufacturer’s instructions and quantified using Nanodrop Spectrophotometer ...
-
bioRxiv - Genetics 2020Quote: ... according to the DNeasy Blood & Tissue kit and DNeasy Micro kit (QIAGEN). Total RNA was extracted from pelleted cells using the Rneasy Mini kit (QIAGEN ...
-
bioRxiv - Microbiology 2019Quote: ... using viral RNA isolation kit (QIAmp Viral RNA Mini Kit Qiagen, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... and extracted with Jetgene mini prep kit (QIAprep Spin Miniprep Kit, QIAGEN). The correctness of constructions was verified by sequencing (Eurofins) ...
-
bioRxiv - Microbiology 2023Quote: ... QIAprep Spin miniprep kit and QIAquick gel extraction kit (Qiagen, Hilden, Germany) were used according to the manufacturer’s protocol to isolate plasmids and to separate PCR products from agarose gels ...
-
bioRxiv - Biochemistry 2023Quote: ... gel extraction kit and PCR clean-up kit was obtained from Qiagen, Hilden ...
-
bioRxiv - Biochemistry 2022Quote: ... QIAGEN Plasmid Maxi Kits and QIAprep Spin Miniprep Kit were from QIAGEN. Zymo PUREII Plasmid Midiprep kit (D4200 ...
-
bioRxiv - Molecular Biology 2023Quote: ... plasmid DNA preparation (QIAprep Spin MiniPrep Kit and Plasmid Midi Kit, Qiagen) and gel electrophoresis were performed according to the manufacturer’s instructions or using standard protocols (29) ...
-
bioRxiv - Cell Biology 2024Quote: DNA was extracted using a commercial kit (DNeasy Blood & Tissue kit, Qiagen). For cDNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... tumefaciens culture was added to 2 ml RNAprotect Bacteria Reagent (Qiagen) and RNA was isolated using RNeasy columns (Qiagen) ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... cleared lysates were incubated with 2 mL Ni-NTA agarose (Qiagen) on a rotator for 1 hour at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Qiaspin Miniprep Kit (Qiagen) and Monarch PCR & DNA Cleanup Kit (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNeasy Mini kit (Qiagen) or miRNeasy Mini kit (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... RNeasy Mini Kit (Qiagen), and DNAse I kit (Qiagen) ...
-
bioRxiv - Immunology 2022Quote: RNeasy Mini Kit (Qiagen) was used for RNA isolation ...