Labshake search
Citations for Qiagen :
1101 - 1150 of 2037 citations for L β Homo β 2 hydroxyphenyl glycine; R 3 Amino 3 2 hydroxyphenyl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... cfDNA was extracted from 2 to 4 ml of plasma using the QIAsymphony liquid handling robot (Qiagen). cfDNA concentration was determined using Qubit double-strand molecular probes kit (Invitrogen ...
-
bioRxiv - Pathology 2022Quote: ... HSP90AB1) and fold changes/regulation of gene expression were calculated using the 2^(−ΔΔCT) formula (GeneGlobe, QIAGEN). Differential expression (up and down regulation ...
-
bioRxiv - Cell Biology 2022Quote: Amplicons were separated on 2% agarose-TAE gels and purified using the QIAquick Gel Extraction Kit (Qiagen). Amplicons were sequenced at Quintarabio ...
-
bioRxiv - Microbiology 2024Quote: ... 2 g of soil were used for RNA extraction using the RNeasy PowerSoil Kit (Qiagen, Venlo, Netherlands) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... 1 mL of culture (0′) was removed and mixed with 2 mL of RNAprotect Bacterial Reagent (QIAGEN), vortexed ...
-
bioRxiv - Genetics 2024Quote: ... 2 or 4 days and genomic DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen). Bisulfite converted DNA libraries were prepared using the Accel-NGS Methyl-Seq DNA library kit (SWIFT BIOSCIENCES) ...
-
bioRxiv - Genomics 2024Quote: RNA was extracted from 2-5 million flash frozen cells using the RNeasy plus mini kit (Qiagen). Libraries were prepared using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (New Englands Biolabs) ...
-
bioRxiv - Microbiology 2023Quote: ... Primers for Jamaican fruit bat genes (Supplemental Table 2) and qPCR was performed (QuantiTech SYBR Green, Qiagen). Within sample gene normalization was performed on Rps18 (ΔCq) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cotyledons from 100 plants were dissected and ground in 2 ml tubes using a Tissue Lyser (Qiagen) for 1 min 30 sec at 30 Hz before RNA extraction using the RNeasy micro kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 mM Tris pH 8.5, 2 mM MgCl2, 0.5% NP40, 0.5% Tween20, 0.05 U/mL QIAGEN protease) and following the procedure described in (42) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The lysate was passed three times through 2 mL of pre-equilibrated Ni-NTA Agarose beads (Qiagen) in a gravity flow column and then washed with 300 mL of lysis buffer D ...
-
bioRxiv - Biochemistry 2022Quote: IQN17 was crystallized at room temperature in a hanging-drop vapor diffusion system by mixing 0.3 μL of 15 mg/mL peptide with 0.3 μL of reservoir solution containing 0.1 M imidazole (pH 8.0) and 35 % 2-methyl-2,4-pentanediol (MPD) (Qiagen). Crystals were seen two days after trays were set up ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was extracted from 2 biological replicates of fecal pellets using DNeasy PowerLyzer PowerSoil kit (Qiagen). Concentration of Pc and Bt DNA was assessed using species-specific qPCR primers (Key Resources Table) ...
-
bioRxiv - Biophysics 2023Quote: ... The filtered supernatant was loaded onto 2 gravity columns each with 4 mL Ni-NTA agarose (Qiagen). The resin was pre-equilibrated with the lysis buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... The soluble fraction was collected and incubated with 2 mL of Ni-NTA Superflow affinity resin (Qiagen), previously equilibrated with lysis buffer ...
-
bioRxiv - Microbiology 2024Quote: ... Total RNA was extracted at 2 or 8 hpi with DNeasy Blood/Tissue DNA mini kit (Qiagen) and quantitated by a nanodrop spectrophotometer ...
-
bioRxiv - Genetics 2024Quote: ... the final pool was purified from a 2% agarose gel (QIAEX II Gel Extraction Kit, Qiagen #20021).
-
bioRxiv - Microbiology 2024Quote: ... approximately 1 × 109 CFU of bacteria were mixed at a 2:1 (vol:vol) ratio of RNAProtect (Qiagen) and incubated at room temperature for 5 min ...
-
bioRxiv - Plant Biology 2024Quote: ... Each extraction step was carried out for 2 h in a TissueLyser II (Qiagen AB, Sollentuna, Sweden) at 6 s-1 at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... and centrifuged (2 minutes 12,000 RPM) before DNA-containing supernatant (2µL) was added to PCR master mix (18µL, Qiagen 201203 ...
-
bioRxiv - Microbiology 2024Quote: ... then homogenised with a steel ball for 2 minutes at 25 Hz using a Tissue-Lyser (Qiagen). CFU was quantified by plating to MacConkey agar containing 50 ug / ml streptomycin.
-
bioRxiv - Immunology 2024Quote: mTEC subpopulations were sorted and lysed in 20µl Lysis Buffer (0.02% 2-ME in 2x TCL (Qiagen)) using BD FACSAria TM III cell sorter (BD) ...
-
bioRxiv - Bioengineering 2024Quote: ... lysis buffer and homogenized at 1000 rpm for 2 min with 5 mm Stainless Steel Beads (Qiagen) using 1600 MiniG Tissue Homogenizer (SPEX SamplePrep) ...
-
bioRxiv - Bioengineering 2024Quote: ... plasmids were purified from the 2-mL culture and eluted using 50 µL EB buffer from QIAGEN. The concentration usually was 50 ng/µL ...
-
bioRxiv - Cancer Biology 2024Quote: ... for 2 hours at 37°C and subsequently purified using the QIAquick PCR Purification Kit (Qiagen, 28106). The modified lentiGuide-puro vector (Addgene Plasmid #52963 ...
-
bioRxiv - Genomics 2024Quote: ... each mock community (Supplementary Table 2) was extracted with EZ1 DNA Tissue Kit (Qiagen; 953034; EZ1 method) and a separate aliquot with TRI Reagent® (Zymo Research ...
-
bioRxiv - Cell Biology 2024Quote: ... with 2-mercaptoethanol and stored at -80 °C until purification with a RNeasy Plus Micro Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... Ni-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen) was used to purify the protein via gravity flow and proteins were eluted as previously described37,38 ...
-
bioRxiv - Microbiology 2021Quote: ... and associated nucleic acid extraction (Qiagen, Germany) kits were used ...
-
bioRxiv - Genomics 2024Quote: ... and QIAamp Circulating Nucleic Acid Kit (Qiagen) for EAC samples ...
-
bioRxiv - Microbiology 2024Quote: ... Ni-nitrilotriacetic acid (NTA) beads (Qiagen, USA) were used to purify the protein ...
-
bioRxiv - Pathology 2024Quote: ... the Circulating Nucleic Acid Kit (Qiagen, 55114) was employed with specific modifications to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... snap frozen samples were homogenized in an Eppendorf tube using a 3-mm Tungsten carbide beads and TissueLyser II system (Qiagen; 4 min at 30 Hz). RNA isolation steps were followed as mentioned above in this section ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.8□l of forward and reverse primer at 5□M concentration and 10□l QuantiNova (Qiagen), made up to a final volume of 20□l with nuclease-free water ...
-
bioRxiv - Cell Biology 2021Quote: ... Gene of interest (GOI) siRNA or control siRNA were incubated at room temperature with Enhancer R and Buffer EC-R (Qiagen, USA) for 20 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... atg8h (F-TGCAGTTAGATCCATCCAAAGCTC, R-TCCATGCGACTAGCGGTTTGAG) and atg7 (F-ACGTGGTTGCACCTCAGGATTC, R- ACTAAGAGTTCAACGGCGAGAGC) were quantified using QuantiNova SYBR green PCR kit (Qiagen, 208056) with LightCycler380 in Wt ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 mL of stabilization mix (RNAprotect Bacteria Reagent - Qiagen diluted with PBS in a 2:1 volume ratio) was applied on plates ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNAs were isolated from 6-month H19ΔICR/H19ΔICR and H19+/H19+ littermates (2 per genotype) using RNeasy Plus Mini Kit (Qiagen). Samples with RNA Integrity numbers >9 were Ribosomal RNA depleted using RiboZero Gold Kit (Illumina) ...
-
bioRxiv - Neuroscience 2020Quote: ... The 205bp amplicon from PCR 2 was gel extracted using the MinElute gel extraction kit (Qiagen Cat#: 28606), and sent to Genewiz for Amplicon-EZ targeted deep sequencing and Sanger sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... The PCR #2 products were validated using gel electrophoresis and purified using the QIAquick Gel extraction kit (QIAGEN). The purified libraries were then quantified by Nanodrop and Qubit prior to sequencing on an Illumina MiSeq.
-
bioRxiv - Systems Biology 2021Quote: ... Differences between samples and controls were calculated based on the 2−ΔΔCT method using RNU6 control primer (Qiagen) as normalizer ...
-
bioRxiv - Plant Biology 2020Quote: ... Total RNA was extracted from 2-week-old Arabidopsis seedlings using an RNeasy Plant Mini Kit (Qiagen, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... single cell directly into 2 µl lysis buffer (30 mM Tris-HCl [pH = 8.0], 10 mM NaCl, 0.2 µL Proteinase K [Qiagen, #19133] ...
-
SARS-CoV-2 comprehensive receptor profiling: mechanistic insight to drive new therapeutic strategiesbioRxiv - Cell Biology 2021Quote: ... each pre-incubated at a 2:1 molar ratio with Penta His Alexa Fluor 647 Conjugate (Qiagen, UK). Hits (duplicate AF647 positive spots ...
-
The formation of a fuzzy complex in the negative arm regulates the robustness of the circadian clockbioRxiv - Molecular Biology 2022Quote: ... The soluble fraction was split between two columns each with 2 ml Ni-NTA agarose beads (Qiagen, 30210) pre-equilibrated with Lysis Buffer ...
-
bioRxiv - Developmental Biology 2022Quote: ... The concentrated SPACA6-containing media was applied onto a 2-mL column of Ni-NTA agarose resin (Qiagen). The Ni-NTA resin was washed with 10 column volumes (CV ...
-
bioRxiv - Immunology 2022Quote: ... The upper aqueous phase containing RNA was carefully transferred to a 2 ml collection tube (cat. 990381, Qiagen) without touching the interphase and placed in a QIAcube instrument for extraction.RNA extraction was carried out using the recommended protocol (FIW-50-001-J_FW_MB and PLC program version FIW-50-002-G_PLC_MB ...
-
bioRxiv - Immunology 2020Quote: ... The SARS-CoV-2 RBD-His protein was purified from cell culture supernatant using a Ni-NTA (Qiagen) affinity column ...
-
bioRxiv - Plant Biology 2020Quote: ... The clear supernatant was then gently mixed with 1 ml of Ni+2-NTA agarose beads (Qiagen, Germany) for 30 min and then added to the column with a flow rate of 0.5 ml/min ...
-
bioRxiv - Immunology 2021Quote: ... Both barcode and digested fragment products were run on a 2% gel and purified by gel extraction (Qiagen). NGS library was sequenced using an Illumina MiSeq and Illumina v3 MiSeq Reagent Kits with 150 base pair single-end sequencing according to standard manufacturer protocols ...