Labshake search
Citations for Qiagen :
1101 - 1150 of 4207 citations for 6H 1 3 Thiazin 6 one 2 ethoxy 4 hydroxy 5 nitro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: DNA from two separate stage 42 embryos of F0 Cab and F0 Kaga and one stage 42 embryo of F1 hybrid Kaga/Cab was extracted using DNeasy Blood and Tissue Kit (Qiagen #69504) following the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were seeded at 3 × 105 cells.well−1 in 6-well plates and transfected 24 h later with one pmiRGLO derivative construct per well (0.9 µg plasmid) using Effectene (Qiagen cat. #301425). After 3 days the cells were washed with PBS and lysed with Cell Culture Lysis Buffer (Promega cat ...
-
bioRxiv - Microbiology 2023Quote: Total DNA was isolated from the whale blow and technical control samples in one batch using a QIAamp DNA Mini Kit (QIAGEN, Germany). The primers used for sequencing the 16SrRNA V3 and V4 regions were 341F (5’-CCTACGGGNGGCWGCAG ...
-
bioRxiv - Genetics 2023Quote: ... Further confirmation of which allele was deleted in clones with only one UBE3A copy was performed by utilizing the EpiTect Methyl II DNA Restriction Kit (QIAGEN, #335452) to measure methylation at the PWS-IC (SNRPN ...
-
bioRxiv - Neuroscience 2023Quote: ... One well of a 60-80% confluent 12-well was harvested with 700 μl QIAzxol Lysis Reagent (Qiagen; Cat. No. 79306) for subsequent RNA extraction with RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Developmental Biology 2024Quote: ... 10 katna1-/-MZ and one pool of 10 wild-type embryos (at 24 hpf) using the RNeasy Mini-kit (Qiagen, France) and reverse-transcribed using the Superscript RT II Kit with random hexamers (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2024Quote: We extracted DNA from one of the two duplicate swabs using a modified version of the DNeasy® Blood and Tissue kit (QIAGEN) optimized to recover DNA from swabs ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 2 μL of 0.1 M Dithiothreitol (Qiagen), 1 μL of 10 mM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Systems Biology 2019Quote: ... Approximately ∼50 mg frozen tissue was pulverised in methanol-chloroform (300 µl, 2:1 v/v) using a TissueLyser (Qiagen, West Sussex, UK). Then the mixture was sonicated for 10 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... total RNA from untreated or RSL3-treated (with or without 2 hr pre-treatment with 2 µM Ferrostatin-1) MM1S and MM1R cells was extracted using the RNeasy Mini Kit (Qiagen, Venlo, the Netherlands) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2019Quote: RNA was extracted from pools of 6 × 105 FACS-isolated cells using the miRNeasy Micro Kit (Qiagen). Quantification of total RNA was performed by Qubit® RNA BR Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were transfected in 10 cm2 or 6-well plates at ∼60% confluency using PolyFect (Qiagen 301107) and washed with complete media 6 h later.
-
bioRxiv - Plant Biology 2020Quote: ... Total RNA (at least 6 μg) was extracted using the RNeasy Plant Mini kit (Qiagen, Hilden, Germany), with an additional step to remove contaminating DNA ...
-
bioRxiv - Plant Biology 2020Quote: ... 6 and 48 HAT to ammonium or nitrate amended plates using RNeasy® Plant Mini kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: SH-SY5Y cells plated in 6-well plates were lysed using 750ul of QIAzol Lysis reagent (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... GAS and SOL muscles from 6 mice per group were pulverized and lysed in RLT buffer (Qiagen) and treated with proteinase K (Qiagen ...
-
bioRxiv - Microbiology 2019Quote: ... qPCR cycles were run as described elsewhere 6 but using a Rotor Gene-Q instrument (QIAGEN, GER). To quantify the relative abundance of Cori and ter chromosomal regions in each sample ...
-
bioRxiv - Immunology 2022Quote: BMDMs were grown in 6-well plates and RNA was isolated using the RNeasy Mini kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: Total RNA from cardiomyocytes was obtained on day 6 post adenovirus infection using the RNeasy kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: RNA was extracted from cortical neurons on 6 cm dishes using RNeasy Plus Mini Kit (QIAGEN, 74134) and reverse-transcribed using SuperScript II (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: Amplification was carried out in a Rotor Gene thermocycler 6-plex with Quantitect Multiplex PCR kit (Qiagen) with 0,24μM of each primer y 0,25μM of each probe under the following conditions ...
-
bioRxiv - Bioengineering 2023Quote: ... gDNA was purified from cells in 6-well plates using the DNeasy blood and tissue kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: Fibroblasts were grown to confluency in 6-well plates and total RNA extracted using RNeasy Kit (Qiagen). Poly(A)-tailed RNA enrichment and library construction was performed using KAPA stranded mRNA-Seq Kit with KAPA mRNA capture beads (KAPABiosystems) ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted from all samples (5 CTRL and 5 SCZ subjects at six timepoints across astrocyte differentiation) using either the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) or the MagMax mirVana Total RNA Isolation Kit (Thermo Fisher) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 0.1 g of tissue per 1 mL of PBS was homogenized with stainless steel beads of 5 mm (25–30 Hz for 5 min) by a Tissuelyser (Qiagen, Venlo, Netherlands). The homogenates were centrifuged at 10,000 x g for 10 min and the supernatant was collected and stored at −80 °C until CD quantification ...
-
bioRxiv - Microbiology 2024Quote: ... IFAS and LifeGuard Soil Preservation were transferred into a 5 mL bead beating tube from DNeasy PowerWater kits for 5-minutes of vortexing (Qiagen, Hilden, Germany). Afterwards ...
-
bioRxiv - Developmental Biology 2021Quote: ... we added a 5-mm stainless steel bead (QIAGEN) and 100 μl of PBS to each tube and lysed the samples by TissueLyser II (QIAGEN ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 μg total RNA was treated with DNase (Qiagen) and purified (RNeasy Kit ...
-
bioRxiv - Cell Biology 2021Quote: ... A single sterile 5 mm stainless steel bead (Qiagen) was added to each tube ...
-
bioRxiv - Neuroscience 2022Quote: ... and added 5 volume PB including pH-indicator (Qiagen) and 200 μL sodium-acetate (3M ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.1 µl Hot Start Polymerase (Qiagen, 5 U/ µl), 20 ng/µl DNA template (95°C for 5 min ...
-
bioRxiv - Cell Biology 2022Quote: ... siWDR1 (5’-GGTGGGATTTAGGCAATTATT) and AllStars Negative Control siRNA (Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... 5 μl of Taq PCR Master Mix kit (Qiagen), 0.4 μl of each primer (100 pmol/μl ...
-
bioRxiv - Biochemistry 2021Quote: ... A 5 ml Strep-tactin Superflow Plus column (Qiagen) was equilibrated with 50 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... with a 5 mm diameter stainless steel bead (Qiagen) for a total of 6 min (2 x 3 min with 1 min on ice in between homogenisations ...
-
bioRxiv - Immunology 2021Quote: ... Plates contained 5 µl of TCL lysis buffer (Qiagen) supplemented with 1%β-mercaptoethanol ...
-
bioRxiv - Genomics 2021Quote: ... 5 μl of nuclease free water (Qiagen, Hilden, Germany) and 5 μl of template RNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and a 5 mm stainless steel bead (Qiagen #69989) in an RNase-free microcentrifuge tube ...
-
bioRxiv - Neuroscience 2022Quote: ... containing 5 mm stainless steel beads (QIAGEN Cat#69989). To these tubes ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 µl SYBR Green Mix (Qiagen N.V., Venlo, Netherlands), and 3 µl nuclease-free water (total volume ...
-
bioRxiv - Physiology 2023Quote: ... and homogenized using 5-mm steel beads (Qiagen #69989) in a bead mill (Qiagen TissueLyser LT) ...
-
bioRxiv - Microbiology 2023Quote: ... 5×105 cells were lysed in RLT buffer (QIAGEN) with 10 μL of β-mercaptoethanol ...