Labshake search
Citations for Qiagen :
1101 - 1150 of 2214 citations for 5 Bromo 2 Tert Butyldimethylsilyl 4 Methylthiazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 1 mL of sample culture was immediately transferred into 2 mL RNA protect bacteria (QIAGEN) and vortexed ...
-
bioRxiv - Plant Biology 2023Quote: ... Christ) and ground to powder at 30 Hz for 2 × 45 s (TissueLyzer II, Qiagen). DNA was extracted according to the manufacturers instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR primers were designed using the PyroMark Assay Design 2.0 software (Qiagen, Supplementary Table 2). The assay for MBP was tested for its sensitivity using the EpiTect PCR Control DNA Set (Qiagen) ...
-
bioRxiv - Immunology 2022Quote: ... siRNA-transfection reagent complexes were generated using 2 μL HiPerfect transfection reagent (Qiagen, Germantown, MD) and 25-50 nM siRNA (non-specific control siRNA (sc-37007 ...
-
bioRxiv - Microbiology 2023Quote: ... then 50 mg transferred to 2 ml Plant Pro tissue disruption tubes (Qiagen Ltd, U.K.). DNA was extracted following manufacturers protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA was run on 2% agarose gel and extracted using QIAquick Gel Extraction Kit (QIAGEN). Fragments and backbone were ligated using T4 DNA ligase (Cat# M0202 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 15 µl reactions each contained 2 × reaction mix from the Multiplex PCR Kit (Qiagen), 5 µg Bovine Serum Albumin ...
-
bioRxiv - Genomics 2023Quote: ... RNAse A treatment was conducted by adding 2 uL of RNAse A 100ug/mL (Qiagen) and incubating the samples at 37°C for 15 min ...
-
bioRxiv - Immunology 2023Quote: ... DNA was isolated for each fraction using EZ1&2 DNA Blood 350µL kits (Qiagen, Hilden) and the EZ1 Advanced XL automated system (Qiagen ...
-
bioRxiv - Genetics 2023Quote: ... we extracted genomic DNA from 2 million cells using DNeasy Blood & Tissue Kit (69504, Qiagen) and performed droplet digital PCR (ddPCR ...
-
bioRxiv - Plant Biology 2023Quote: Genomic DNA was extracted from 2-week old seedlings with DNeasy Plant Mini Kit (Qiagen) and further purified with Isolate II Gel and PCR Clean-up Kit (Bioline) ...
-
bioRxiv - Genomics 2023Quote: ... Cell-free RNA was isolated from between 2-8 mL following manufacturer’s instructions (Qiagen, 55114). Isolated RNA was DNase-treated (Lucigen ...
-
bioRxiv - Microbiology 2023Quote: ... we placed filters in 2 mL tubes with beads and 1 mL TE buffer (Qiagen plasmid isolation kit ...
-
bioRxiv - Biochemistry 2023Quote: Total RNA was extracted from 1 – 2 x 108 cells using the RNeasy kit (Qiagen). DNA was removed using Turbo DNase (Applichem ...
-
bioRxiv - Plant Biology 2024Quote: ... all samples were ground for 2 minutes at 25 Hz (TissueLyser II, QIAGEN, Hilden, Germany). A dilution series was performed on this mixture with MgCl2 (10 mM ...
-
bioRxiv - Immunology 2024Quote: ... PCR products were purified from 2 % agarose-gels using QIAquick Gel Extraction Kit (QIAGEN, 28706) for Sanger sequencing (Microsynth).
-
bioRxiv - Microbiology 2024Quote: ... The paper circles were transferred to PowerBead Pro Tubes (2 ml) (cat. no. 19301, Qiagen) containing pre-loaded homogenization beads.
-
bioRxiv - Immunology 2024Quote: ... 2×106 MDSCs were used for RNA extraction using the Rnaeasy Plus Kit (Qiagen # 4134), according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: ... 2 µL of sonicated RNA per sample was purified with miRNeasy Micro Kit (Qiagen, 217084) and treated with DNase I (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... LF/LF = 5 mice from two cages over two experiments) using the DNeasy PowerSoil Kit (Qiagen, Germantown, MD). Modifications to the standard protocol included a 10-minute incubation at 65°C immediately following the addition of the lysis buffer and the use of a bead mill homogenizer at 4.5 m/s for 1 min ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA-Seq libraries were prepared from 5 ng total RNA using the NEB Next RNA Ultra Kit (QIAGEN) with poly(A ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Microbiology 2021Quote: ... 20 mM imidazole was added to the supernatant and incubated with 5 mL of Ni-NTA resin (Qiagen) with a stirring magnet at 4°C for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Immunology 2022Quote: ... and 5 cells per well were sorted into a 96-well plate containing TCL buffer (Qiagen, cat. 1031576) with 1 % beta- Mercaptethanol and snap frozen on dry ice ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from CTLs (days 0, 5 and 7) using the RNeasy Plus Mini Kit (Qiagen. #74136), reverse transcribed to first-strand cDNAs using iScript™ cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... total DNA from 5 × 105 J-Lat cells was purified using Qiagen blood mini kit (Qiagen, Hilden, Germany) and quantitated spectrophotometrically ...
-
bioRxiv - Microbiology 2021Quote: ... prior to the addition of proteinase K and 5 μl of 100 mg ml−1 RNase A (Qiagen). The DNA concentration was determined using a Qubit fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... total RNA was isolated from 5 × 105 cells with the AllPrep© DNA/RNA/Protein Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA for expression analyses was extracted from 5 day-old protonemata using a RNeasy Plant Mini Kit (Qiagen). Genomic DNA removal and cDNA synthesis were performed with a Quantitect Reverse Transcription kit (Qiagen).
-
bioRxiv - Developmental Biology 2021Quote: Log fold-change values of the top 5% proteins were used as input for Ingenuity Pathway Analysis (Qiagen: https://digitalinsights.qiagen.com/products/features/) ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was extracted from 5×106 cells per sample using the AllPrep DNA/RNA/miRNA Universal Kit (QIAGEN) according to manufacturer’s recommendations with additional DNase I treatment for RNA extraction ...
-
bioRxiv - Developmental Biology 2022Quote: ... Complementary DNA of microRNAs was synthesized from 5 μg total RNA using microRNA-specific primers (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Genomic DNA was eluted from the column using 5 mL of prewarmed (50°C) QF Buffer (Qiagen, Germany). DNA was precipitated by adding 0.7 volumes of isopropanol ...
-
bioRxiv - Microbiology 2022Quote: DNA was extracted from the Sterivex filters (i.e., 0.22–5 μm size fraction) using an AllPrep DNA/RNA Mini Kit (80204; Qiagen) with a modified protocol ...
-
bioRxiv - Microbiology 2022Quote: RNA was extracted from 5-10 snap-frozen larvae with the RNeasy Mini kit (Qiagen cat no. 74104) and reverse-transcribed using QuantiTect Reverse Transcription kit (Qiagen cat no 205311 ...
-
bioRxiv - Immunology 2022Quote: Total RNA from ~ 5 × 105 neutrophils (CD45+Lin-CD11b+Ly6G+) was isolated with the RNeasy micro kit (Qiagen) and RNA quality was checked with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2022Quote: Whole RNA was extracted from over 1 × 10^5 cells using the QIAGEN RNeasy Micro kit (QIAGEN, 74004) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid DNA was extracted from 5 mL of this culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). Glycerol was added to the remaining culture to a final concentration of 15% (v/v ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid DNA was extracted from 5 mL of this culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). The remaining 95 mL of culture was combined with 40.7 mL 50% glycerol (v/v) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were eluted using an imidazole gradient and subsequently loaded onto a 5 ml StrepTactin Superflow Cartridge (Qiagen) at a flow rate of 0.8 ml/min ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR amplification was carried out in 5 µl reactions using the QIAGEN Multiplex PCR Kit (QIAGEN, Germany). Each sample reaction contained 10–20 ng of genomic template DNA ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... A 5 ml aliquot of culture was removed and added to 10 ml of RNAprotect Bacteria Reagent (Qiagen) and mixed by vortexing ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Microbiology 2023Quote: ... Edmund Bühler) by bead beating twice for 5 min at 30 Hz in a Tissue Lyzer II (QIAGEN). Lysates were then incubated for 30 min at 37 °C with shaking ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA from 5-day-old whole plants was extracted using the RNeasy Plant Mini Kit (Qiagen, 74904). For RNA-seq ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from 5-10 g of soil per sample with the DNeasy PowerMax Soil Kit (Qiagen) and used for short read and long read sequencing ...
-
bioRxiv - Physiology 2023Quote: ... a 5 mg piece of kidney tissue was homogenized in 350 μL of RNeasy RLT Lysis buffer (Qiagen) containing 2-mercaptoethanol and centrifuged at maximum speed for 3 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... Sequences with an E-value lower than 1e-5 were used for multiple sequence alignment using CLC v 21.0.5 sequence manager (Qiagen). After multiple rounds of alignments and manual removing non-nAChR sequences a set of 2047 proteins were obtained ...