Labshake search
Citations for Qiagen :
1051 - 1100 of 3706 citations for Monocyclohexyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... directly lysed in 2.1 mL QIAzol (Qiagen), spiked with 4sU-labeled mouse cell lysates ...
-
bioRxiv - Physiology 2023Quote: ... and Protease XIV (0.2 mg/ml, Qiagen) were used in the presence of fetal bovine serum.
-
bioRxiv - Molecular Biology 2023Quote: ... RNAse A (5 μg/mL, Qiagen #19101) was added to the whole cell extracts (WCE ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2.7 × 10−5 AU/mL protease (Qiagen), 1.0 μM barcoded oligodT-ISPCR primer ...
-
bioRxiv - Microbiology 2024Quote: ... 10 μg/ml RNase-free DNase (Qiagen), and 1 uL/ml of RNaseOUT (Thermo Fisher) ...
-
bioRxiv - Microbiology 2024Quote: ... 10 ml of RNAprotect Bacteria Reagent (Qiagen) was added to cultures ...
-
bioRxiv - Molecular Biology 2019Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... 100 µg of RNA per sample was purified using an RNeasy Kit (Qiagen) including a second on-column DNase digestion according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Libraries were size-selected at 100-700 bp by gel extraction (28604, Qiagen). Libraries were quantified with KAPA qPCR and bioanalyzer prior to pair-end sequencing on Illumina HiSeq 2000.
-
bioRxiv - Cancer Biology 2019Quote: All tissues were dissociated in 100 mM sodium carbonate using TissueLyzer II (QIAGEN) for 0.5 min at a rate of 0.30 repetitions three times and stored on ice for 30 sec between the dissociation cycles ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA was extracted from 100 oocytes with RNeasy micro purification kit (Qiagen). The first strand cDNA was generated with M-MLV first strand cDNA synthesis kit (Takara) ...
-
bioRxiv - Neuroscience 2021Quote: ... Fly heads were homogenized in 100 µl RTL buffer from RNeasy kit (Qiagen) using a motorized pestle ...
-
bioRxiv - Microbiology 2021Quote: ... DNA pellets were collected by centrifugation and resuspended in 100 μl EB (Qiagen) by vigorous shaking for 10 min at 55°C ...
-
bioRxiv - Plant Biology 2021Quote: The samples (100 mg) were powdered using a TissueLyser II (Qiagen, Hilden, Germany). The powdered samples were used to quantify the starch ...
-
bioRxiv - Cell Biology 2020Quote: ... Transfections were carried out with 100 nM miRNA-221-3p mimic (Qiagen MSY0000278), anti-miR-221-3p (Qiagen MIN0000278 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... following the manufacturer’s protocol and eluted in 100 μL of TE buffer (Qiagen).
-
bioRxiv - Cell Biology 2022Quote: ... Islets were frozen at −80°C in 100 μL of RLT buffer (Qiagen) with beta mercaptoethanol (1%) ...
-
bioRxiv - Biochemistry 2020Quote: ... each 100 μl reaction was purified using a QIAquick PCR Purification Kit (Qiagen) according to the manufacturer’s protocol and eluted in 30 μl of nuclease-free water ...
-
bioRxiv - Microbiology 2021Quote: ... gDNA extraction was performed using the Genomic-tip DNA 100/G Kit (Qiagen), following the Tissue Sample method ...
-
bioRxiv - Microbiology 2021Quote: ... pH 8.0) and a 100-bp GelPilot® DNA Molecular Weight Marker (Qiagen).
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we incubated samples with Qiagen Solution C3 (Qiagen DNeasy PowerSoil 12888-100-3) to remove PCR inhibitors ...
-
bioRxiv - Molecular Biology 2022Quote: ... Product longer than 100 nt was recovered using QIAquick Gel Extraction Kit (Qiagen) after separation of the ligation products with TBE-Urea 10% Gel (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... Genomic DNA was extracted using the DNeasy PowerLyzer PowerSoil Kit (12855-100, QIAGEN) according to manufacturer’s protocol with a minor modification ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 100 µl of lysis buffer from the QIAGEN RNeasy mini kit (Qiagen, #74104) was added to each well to lyse the cells ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we incubated samples with Qiagen Solution C3 (Qiagen DNeasy PowerSoil 12888-100-3) to remove PCR inhibitors ...
-
bioRxiv - Microbiology 2023Quote: ... were transfected with either 100 nM of the specific YTHDF1 siRNA (SI00764715, Qiagen) or 100 nM siGENOME non-targeting siRNA (Dharmacon ...
-
bioRxiv - Physiology 2023Quote: RNA was harvested with 100 µL of QIAzol Lysis Reagent (Qiagen, Hilden, DE) per well of an MEA plate ...
-
bioRxiv - Cancer Biology 2022Quote: A 100 µL slurry of 5% Ni-NTA magnetic beads (Qiagen, part# 36113) was placed in 12 1.5 mL Eppendorf tubes and the tubes were placed in a magnetic stand and the supernatant was removed ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were precipitated by adding 100 μL of a protein precipitation solution (Qiagen). Samples were centrifuged for 5 min at 13000 rpm ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA was extracted from the cells using Genomic-Tip 100/ G (QIAGEN). To obtain long reads ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The samples were centrifuged and the supernatant mixed with 13 mL of a modified PB buffer (12.6 mL PB buffer (Qiagen), 6.5 μL Tween-20 ...
-
bioRxiv - Plant Biology 2021Quote: ... the protein was removed by 1.1 μL of proteinase K (20mg/ml) at 45° C for 1h and RNA by 2μL of RNaseA (1mg/ml) (Qiagen) digestion at 37°C for 1h ...
-
bioRxiv - Molecular Biology 2020Quote: ... washed twice in PBS and DNA was labeled with propidium iodide (50 μg/ml) in presence of RNase A (0.2 mg/ml, Qiagen) and Triton X-100 (0.1%) ...
-
bioRxiv - Microbiology 2019Quote: ... Bacteria were treated with lysostaphin (2.5 mg/mL) and lysozyme (50 mg/mL) prior to RNA extraction using the RNeasy Plus Mini Kit (Qiagen). RNAs were treated with TURBO DNA-free™ (Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNA was labeled with propidium iodide (50 μg/ml) in the presence of RNase A (0.2 mg/ml, Qiagen) and Triton X-100 (0.01% ...
-
bioRxiv - Molecular Biology 2022Quote: ... The supernatant was loaded onto a 10 mL Ni-NTA Superflow cartridge (connected two 5 mL cartridges) (30761, Qiagen). The cartridge was washed with 100 mL R buffer containing 200 mM NaCl ...
-
bioRxiv - Microbiology 2023Quote: ... Cells suspended in lysis buffer were transferred to a 2 mL screw cap tube that contained 0.5 mL of 0.1 mm disruption beads for bacteria and 0.7 mL QIAzol™ Lysis Reagent (Qiagen; 79306). Cells were lysed via mechanical disruption using a bead beater for four rounds of 30 s each ...
-
bioRxiv - Cell Biology 2024Quote: ... were incubated in a 50 µL reaction with or without triton-x (1% v/v) and with or without proteinase K (Qiagen #19131, final concentration 20 µg/mL) for 15 minutes at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... The first round of PCR was carried out using the ImmunoSEQ proprietary PCR primer mix (32 μL per sample containing 25 uL of QIAGEN 2× Multiplex PCR Master Mix, 5μL of QIAGEN 5x Q-solution and 2 μL of primer mix). A positive control reaction ...
-
bioRxiv - Microbiology 2021Quote: ... 1 g yeast extract in 750 ml of 30 kDa filtered seawater and 250 ml of Milli-Q water) using the DNeasy Blood & Tissue kit (Qiagen) following the manufacturer’s recommendations ...